man > perlretut(1)

PERLRETUT(1)                      Perl Programmers Reference Guide                      PERLRETUT(1)

NAME
       perlretut - Perl regular expressions tutorial

DESCRIPTION
       This page provides a basic tutorial on understanding, creating and using regular expressions
       in Perl.  It serves as a complement to the reference page on regular expressions perlre.
       Regular expressions are an integral part of the "m//", "s///", "qr//" and "split" operators
       and so this tutorial also overlaps with "Regexp Quote-Like Operators" in perlop and "split"
       in perlfunc.

       Perl is widely renowned for excellence in text processing, and regular expressions are one of
       the big factors behind this fame.  Perl regular expressions display an efficiency and
       flexibility unknown in most other computer languages.  Mastering even the basics of regular
       expressions will allow you to manipulate text with surprising ease.

       What is a regular expression?  At its most basic, a regular expression is a template that is
       used to determine if a string has certain characteristics.  The string is most often some
       text, such as a line, sentence, web page, or even a whole book, but it doesn't have to be.
       It could be binary data, for example.  Biologists often use Perl to look for patterns in long
       DNA sequences.

       Suppose we want to determine if the text in variable, $var contains the sequence of
       characters "m u s h r o o m" (blanks added for legibility).  We can write in Perl

        $var =~ m/mushroom/

       The value of this expression will be TRUE if $var contains that sequence of characters
       anywhere within it, and FALSE otherwise.  The portion enclosed in '/' characters denotes the
       characteristic we are looking for.  We use the term pattern for it.  The process of looking
       to see if the pattern occurs in the string is called matching, and the "=~" operator along
       with the "m//" tell Perl to try to match the pattern against the string.  Note that the
       pattern is also a string, but a very special kind of one, as we will see.  Patterns are in
       common use these days; examples are the patterns typed into a search engine to find web pages
       and the patterns used to list files in a directory, e.g., ""ls *.txt"" or ""dir *.*"".  In
       Perl, the patterns described by regular expressions are used not only to search strings, but
       to also extract desired parts of strings, and to do search and replace operations.

       Regular expressions have the undeserved reputation of being abstract and difficult to
       understand.  This really stems simply because the notation used to express them tends to be
       terse and dense, and not because of inherent complexity.  We recommend using the "/x" regular
       expression modifier (described below) along with plenty of white space to make them less
       dense, and easier to read.  Regular expressions are constructed using simple concepts like
       conditionals and loops and are no more difficult to understand than the corresponding "if"
       conditionals and "while" loops in the Perl language itself.

       This tutorial flattens the learning curve by discussing regular expression concepts, along
       with their notation, one at a time and with many examples.  The first part of the tutorial
       will progress from the simplest word searches to the basic regular expression concepts.  If
       you master the first part, you will have all the tools needed to solve about 98% of your
       needs.  The second part of the tutorial is for those comfortable with the basics, and hungry
       for more power tools.  It discusses the more advanced regular expression operators and
       introduces the latest cutting-edge innovations.

       A note: to save time, "regular expression" is often abbreviated as regexp or regex.  Regexp
       is a more natural abbreviation than regex, but is harder to pronounce.  The Perl pod
       documentation is evenly split on regexp vs regex; in Perl, there is more than one way to
       abbreviate it.  We'll use regexp in this tutorial.

       New in v5.22, "use re 'strict'" applies stricter rules than otherwise when compiling regular
       expression patterns.  It can find things that, while legal, may not be what you intended.

Part 1: The basics
   Simple word matching
       The simplest regexp is simply a word, or more generally, a string of characters.  A regexp
       consisting of just a word matches any string that contains that word:

           "Hello World" =~ /World/;  # matches

       What is this Perl statement all about? "Hello World" is a simple double-quoted string.
       "World" is the regular expression and the "//" enclosing "/World/" tells Perl to search a
       string for a match.  The operator "=~" associates the string with the regexp match and
       produces a true value if the regexp matched, or false if the regexp did not match.  In our
       case, "World" matches the second word in "Hello World", so the expression is true.
       Expressions like this are useful in conditionals:

           if ("Hello World" =~ /World/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       There are useful variations on this theme.  The sense of the match can be reversed by using
       the "!~" operator:

           if ("Hello World" !~ /World/) {
               print "It doesn't match\n";
           }
           else {
               print "It matches\n";
           }

       The literal string in the regexp can be replaced by a variable:

           my $greeting = "World";
           if ("Hello World" =~ /$greeting/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       If you're matching against the special default variable $_, the "$_ =~" part can be omitted:

           $_ = "Hello World";
           if (/World/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       And finally, the "//" default delimiters for a match can be changed to arbitrary delimiters
       by putting an 'm' out front:

           "Hello World" =~ m!World!;   # matches, delimited by '!'
           "Hello World" =~ m{World};   # matches, note the paired '{}'
           "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
                                        # '/' becomes an ordinary char

       "/World/", "m!World!", and "m{World}" all represent the same thing.  When, e.g., the quote
       ('"') is used as a delimiter, the forward slash '/' becomes an ordinary character and can be
       used in this regexp without trouble.

       Let's consider how different regexps would match "Hello World":

           "Hello World" =~ /world/;  # doesn't match
           "Hello World" =~ /o W/;    # matches
           "Hello World" =~ /oW/;     # doesn't match
           "Hello World" =~ /World /; # doesn't match

       The first regexp "world" doesn't match because regexps are by default case-sensitive.  The
       second regexp matches because the substring 'o W' occurs in the string "Hello World".  The
       space character ' ' is treated like any other character in a regexp and is needed to match in
       this case.  The lack of a space character is the reason the third regexp 'oW' doesn't match.
       The fourth regexp ""World "" doesn't match because there is a space at the end of the regexp,
       but not at the end of the string.  The lesson here is that regexps must match a part of the
       string exactly in order for the statement to be true.

       If a regexp matches in more than one place in the string, Perl will always match at the
       earliest possible point in the string:

           "Hello World" =~ /o/;       # matches 'o' in 'Hello'
           "That hat is red" =~ /hat/; # matches 'hat' in 'That'

       With respect to character matching, there are a few more points you need to know about.
       First of all, not all characters can be used "as-is" in a match.  Some characters, called
       metacharacters, are generally reserved for use in regexp notation.  The metacharacters are

           {}[]()^$.|*+?-#\

       This list is not as definitive as it may appear (or be claimed to be in other documentation).
       For example, "#" is a metacharacter only when the "/x" pattern modifier (described below) is
       used, and both "}" and "]" are metacharacters only when paired with opening "{" or "["
       respectively; other gotchas apply.

       The significance of each of these will be explained in the rest of the tutorial, but for now,
       it is important only to know that a metacharacter can be matched as-is by putting a backslash
       before it:

           "2+2=4" =~ /2+2/;    # doesn't match, + is a metacharacter
           "2+2=4" =~ /2\+2/;   # matches, \+ is treated like an ordinary +
           "The interval is [0,1)." =~ /[0,1)./     # is a syntax error!
           "The interval is [0,1)." =~ /\[0,1\)\./  # matches
           "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/;  # matches

       In the last regexp, the forward slash '/' is also backslashed, because it is used to delimit
       the regexp.  This can lead to LTS (leaning toothpick syndrome), however, and it is often more
       readable to change delimiters.

           "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!;  # easier to read

       The backslash character '\' is a metacharacter itself and needs to be backslashed:

           'C:\WIN32' =~ /C:\\WIN/;   # matches

       In situations where it doesn't make sense for a particular metacharacter to mean what it
       normally does, it automatically loses its metacharacter-ness and becomes an ordinary
       character that is to be matched literally.  For example, the '}' is a metacharacter only when
       it is the mate of a '{' metacharacter.  Otherwise it is treated as a literal RIGHT CURLY
       BRACKET.  This may lead to unexpected results.  "use re 'strict'" can catch some of these.

       In addition to the metacharacters, there are some ASCII characters which don't have printable
       character equivalents and are instead represented by escape sequences.  Common examples are
       "\t" for a tab, "\n" for a newline, "\r" for a carriage return and "\a" for a bell (or
       alert).  If your string is better thought of as a sequence of arbitrary bytes, the octal
       escape sequence, e.g., "\033", or hexadecimal escape sequence, e.g., "\x1B" may be a more
       natural representation for your bytes.  Here are some examples of escapes:

           "1000\t2000" =~ m(0\t2)   # matches
           "1000\n2000" =~ /0\n20/   # matches
           "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
           "cat"   =~ /\o{143}\x61\x74/ # matches in ASCII, but a weird way
                                        # to spell cat

       If you've been around Perl a while, all this talk of escape sequences may seem familiar.
       Similar escape sequences are used in double-quoted strings and in fact the regexps in Perl
       are mostly treated as double-quoted strings.  This means that variables can be used in
       regexps as well.  Just like double-quoted strings, the values of the variables in the regexp
       will be substituted in before the regexp is evaluated for matching purposes.  So we have:

           $foo = 'house';
           'housecat' =~ /$foo/;      # matches
           'cathouse' =~ /cat$foo/;   # matches
           'housecat' =~ /${foo}cat/; # matches

       So far, so good.  With the knowledge above you can already perform searches with just about
       any literal string regexp you can dream up.  Here is a very simple emulation of the Unix grep
       program:

           % cat > simple_grep
           #!/usr/bin/perl
           $regexp = shift;
           while (<>) {
               print if /$regexp/;
           }
           ^D

           % chmod +x simple_grep

           % simple_grep abba /usr/dict/words
           Babbage
           cabbage
           cabbages
           sabbath
           Sabbathize
           Sabbathizes
           sabbatical
           scabbard
           scabbards

       This program is easy to understand.  "#!/usr/bin/perl" is the standard way to invoke a perl
       program from the shell.  "$regexp = shift;" saves the first command line argument as the
       regexp to be used, leaving the rest of the command line arguments to be treated as files.
       "while (<>)" loops over all the lines in all the files.  For each line, "print if /$regexp/;"
       prints the line if the regexp matches the line.  In this line, both "print" and "/$regexp/"
       use the default variable $_ implicitly.

       With all of the regexps above, if the regexp matched anywhere in the string, it was
       considered a match.  Sometimes, however, we'd like to specify where in the string the regexp
       should try to match.  To do this, we would use the anchor metacharacters '^' and '$'.  The
       anchor '^' means match at the beginning of the string and the anchor '$' means match at the
       end of the string, or before a newline at the end of the string.  Here is how they are used:

           "housekeeper" =~ /keeper/;    # matches
           "housekeeper" =~ /^keeper/;   # doesn't match
           "housekeeper" =~ /keeper$/;   # matches
           "housekeeper\n" =~ /keeper$/; # matches

       The second regexp doesn't match because '^' constrains "keeper" to match only at the
       beginning of the string, but "housekeeper" has keeper starting in the middle.  The third
       regexp does match, since the '$' constrains "keeper" to match only at the end of the string.

       When both '^' and '$' are used at the same time, the regexp has to match both the beginning
       and the end of the string, i.e., the regexp matches the whole string.  Consider

           "keeper" =~ /^keep$/;      # doesn't match
           "keeper" =~ /^keeper$/;    # matches
           ""       =~ /^$/;          # ^$ matches an empty string

       The first regexp doesn't match because the string has more to it than "keep".  Since the
       second regexp is exactly the string, it matches.  Using both '^' and '$' in a regexp forces
       the complete string to match, so it gives you complete control over which strings match and
       which don't.  Suppose you are looking for a fellow named bert, off in a string by himself:

           "dogbert" =~ /bert/;   # matches, but not what you want

           "dilbert" =~ /^bert/;  # doesn't match, but ..
           "bertram" =~ /^bert/;  # matches, so still not good enough

           "bertram" =~ /^bert$/; # doesn't match, good
           "dilbert" =~ /^bert$/; # doesn't match, good
           "bert"    =~ /^bert$/; # matches, perfect

       Of course, in the case of a literal string, one could just as easily use the string
       comparison "$string eq 'bert'" and it would be more efficient.   The  "^...$" regexp really
       becomes useful when we add in the more powerful regexp tools below.

   Using character classes
       Although one can already do quite a lot with the literal string regexps above, we've only
       scratched the surface of regular expression technology.  In this and subsequent sections we
       will introduce regexp concepts (and associated metacharacter notations) that will allow a
       regexp to represent not just a single character sequence, but a whole class of them.

       One such concept is that of a character class.  A character class allows a set of possible
       characters, rather than just a single character, to match at a particular point in a regexp.
       You can define your own custom character classes.  These are denoted by brackets "[...]",
       with the set of characters to be possibly matched inside.  Here are some examples:

           /cat/;       # matches 'cat'
           /[bcr]at/;   # matches 'bat, 'cat', or 'rat'
           /item[0123456789]/;  # matches 'item0' or ... or 'item9'
           "abc" =~ /[cab]/;    # matches 'a'

       In the last statement, even though 'c' is the first character in the class, 'a' matches
       because the first character position in the string is the earliest point at which the regexp
       can match.

           /[yY][eE][sS]/;      # match 'yes' in a case-insensitive way
                                # 'yes', 'Yes', 'YES', etc.

       This regexp displays a common task: perform a case-insensitive match.  Perl provides a way of
       avoiding all those brackets by simply appending an 'i' to the end of the match.  Then
       "/[yY][eE][sS]/;" can be rewritten as "/yes/i;".  The 'i' stands for case-insensitive and is
       an example of a modifier of the matching operation.  We will meet other modifiers later in
       the tutorial.

       We saw in the section above that there were ordinary characters, which represented
       themselves, and special characters, which needed a backslash '\' to represent themselves.
       The same is true in a character class, but the sets of ordinary and special characters inside
       a character class are different than those outside a character class.  The special characters
       for a character class are "-]\^$" (and the pattern delimiter, whatever it is).  ']' is
       special because it denotes the end of a character class.  '$' is special because it denotes a
       scalar variable.  '\' is special because it is used in escape sequences, just like above.
       Here is how the special characters "]$\" are handled:

          /[\]c]def/; # matches ']def' or 'cdef'
          $x = 'bcr';
          /[$x]at/;   # matches 'bat', 'cat', or 'rat'
          /[\$x]at/;  # matches '$at' or 'xat'
          /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'

       The last two are a little tricky.  In "[\$x]", the backslash protects the dollar sign, so the
       character class has two members '$' and 'x'.  In "[\\$x]", the backslash is protected, so $x
       is treated as a variable and substituted in double quote fashion.

       The special character '-' acts as a range operator within character classes, so that a
       contiguous set of characters can be written as a range.  With ranges, the unwieldy
       "[0123456789]" and "[abc...xyz]" become the svelte "[0-9]" and "[a-z]".  Some examples are

           /item[0-9]/;  # matches 'item0' or ... or 'item9'
           /[0-9bx-z]aa/;  # matches '0aa', ..., '9aa',
                           # 'baa', 'xaa', 'yaa', or 'zaa'
           /[0-9a-fA-F]/;  # matches a hexadecimal digit
           /[0-9a-zA-Z_]/; # matches a "word" character,
                           # like those in a Perl variable name

       If '-' is the first or last character in a character class, it is treated as an ordinary
       character; "[-ab]", "[ab-]" and "[a\-b]" are all equivalent.

       The special character '^' in the first position of a character class denotes a negated
       character class, which matches any character but those in the brackets.  Both "[...]" and
       "[^...]" must match a character, or the match fails.  Then

           /[^a]at/;  # doesn't match 'aat' or 'at', but matches
                      # all other 'bat', 'cat, '0at', '%at', etc.
           /[^0-9]/;  # matches a non-numeric character
           /[a^]at/;  # matches 'aat' or '^at'; here '^' is ordinary

       Now, even "[0-9]" can be a bother to write multiple times, so in the interest of saving
       keystrokes and making regexps more readable, Perl has several abbreviations for common
       character classes, as shown below.  Since the introduction of Unicode, unless the "/a"
       modifier is in effect, these character classes match more than just a few characters in the
       ASCII range.

       •   "\d" matches a digit, not just "[0-9]" but also digits from non-roman scripts

       •   "\s" matches a whitespace character, the set "[\ \t\r\n\f]" and others

       •   "\w"  matches  a  word  character (alphanumeric or '_'), not just "[0-9a-zA-Z_]" but also
           digits and characters from non-roman scripts

       •   "\D" is a negated "\d"; it represents any other character than a digit, or "[^\d]"

       •   "\S" is a negated "\s"; it represents any non-whitespace character "[^\s]"

       •   "\W" is a negated "\w"; it represents any non-word character "[^\w]"

       •   The period '.' matches any character but "\n" (unless the modifier "/s" is in effect,  as
           explained below).

       •   "\N",  like  the  period,  matches  any  character but "\n", but it does so regardless of
           whether the modifier "/s" is in effect.

       The "/a" modifier, available starting in Perl 5.14,  is used to restrict the matches of "\d",
       "\s", and "\w" to just those in the ASCII range.  It is useful  to  keep  your  program  from
       being  needlessly exposed to full Unicode (and its accompanying security considerations) when
       all you want is to process English-like text.  (The "a" may be  doubled,  "/aa",  to  provide
       even  more  restrictions,  preventing  case-insensitive  matching  of  ASCII  with  non-ASCII
       characters; otherwise a Unicode "Kelvin Sign" would caselessly match a "k" or "K".)

       The "\d\s\w\D\S\W" abbreviations can be used both inside and outside of  bracketed  character
       classes.  Here are some in use:

           /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
           /[\d\s]/;         # matches any digit or whitespace character
           /\w\W\w/;         # matches a word char, followed by a
                             # non-word char, followed by a word char
           /..rt/;           # matches any two chars, followed by 'rt'
           /end\./;          # matches 'end.'
           /end[.]/;         # same thing, matches 'end.'

       Because  a  period is a metacharacter, it needs to be escaped to match as an ordinary period.
       Because, for example, "\d" and "\w" are sets of characters,  it  is  incorrect  to  think  of
       "[^\d\w]" as "[\D\W]"; in fact "[^\d\w]" is the same as "[^\w]", which is the same as "[\W]".
       Think De Morgan's laws.

       In  actuality,  the period and "\d\s\w\D\S\W" abbreviations are themselves types of character
       classes, so the ones surrounded by brackets are just one type of character  class.   When  we
       need to make a distinction, we refer to them as "bracketed character classes."

       An anchor useful in basic regexps is the word anchor "\b".  This matches a boundary between a
       word character and a non-word character "\w\W" or "\W\w":

           $x = "Housecat catenates house and cat";
           $x =~ /cat/;    # matches cat in 'housecat'
           $x =~ /\bcat/;  # matches cat in 'catenates'
           $x =~ /cat\b/;  # matches cat in 'housecat'
           $x =~ /\bcat\b/;  # matches 'cat' at end of string

       Note in the last example, the end of the string is considered a word boundary.

       For  natural  language  processing (so that, for example, apostrophes are included in words),
       use instead "\b{wb}"

           "don't" =~ / .+? \b{wb} /x;  # matches the whole string

       You might wonder why '.' matches everything but "\n" - why not every character? The reason is
       that often one is matching against lines and would like to  ignore  the  newline  characters.
       For  instance,  while  the  string  "\n" represents one line, we would like to think of it as
       empty.  Then

           ""   =~ /^$/;    # matches
           "\n" =~ /^$/;    # matches, $ anchors before "\n"

           ""   =~ /./;      # doesn't match; it needs a char
           ""   =~ /^.$/;    # doesn't match; it needs a char
           "\n" =~ /^.$/;    # doesn't match; it needs a char other than "\n"
           "a"  =~ /^.$/;    # matches
           "a\n"  =~ /^.$/;  # matches, $ anchors before "\n"

       This behavior is convenient, because we usually want to ignore newlines  when  we  count  and
       match characters in a line.  Sometimes, however, we want to keep track of newlines.  We might
       even  want  '^' and '$' to anchor at the beginning and end of lines within the string, rather
       than just the beginning and end of the string.  Perl allows us to choose between ignoring and
       paying attention to newlines by using the "/s" and "/m" modifiers.  "/s" and "/m"  stand  for
       single  line  and  multi-line  and  they  determine  whether a string is to be treated as one
       continuous string, or as a set of lines.  The two modifiers affect two  aspects  of  how  the
       regexp  is  interpreted:  1) how the '.' character class is defined, and 2) where the anchors
       '^' and '$' are able to match.  Here are the four possible combinations:

       •   no modifiers: Default behavior.  '.' matches any character except "\n".  '^' matches only
           at the beginning of the string and '$' matches only at the end or before a newline at the
           end.

       •   s modifier ("/s"): Treat string as a single long line.  '.' matches any  character,  even
           "\n".  '^' matches only at the beginning of the string and '$' matches only at the end or
           before a newline at the end.

       •   m  modifier  ("/m"):  Treat string as a set of multiple lines.  '.' matches any character
           except "\n".  '^' and '$' are able to match at the start or end of any  line  within  the
           string.

       •   both  s  and m modifiers ("/sm"): Treat string as a single long line, but detect multiple
           lines.  '.' matches any character, even "\n".  '^' and '$', however, are able to match at
           the start or end of any line within the string.

       Here are examples of "/s" and "/m" in action:

           $x = "There once was a girl\nWho programmed in Perl\n";

           $x =~ /^Who/;   # doesn't match, "Who" not at start of string
           $x =~ /^Who/s;  # doesn't match, "Who" not at start of string
           $x =~ /^Who/m;  # matches, "Who" at start of second line
           $x =~ /^Who/sm; # matches, "Who" at start of second line

           $x =~ /girl.Who/;   # doesn't match, "." doesn't match "\n"
           $x =~ /girl.Who/s;  # matches, "." matches "\n"
           $x =~ /girl.Who/m;  # doesn't match, "." doesn't match "\n"
           $x =~ /girl.Who/sm; # matches, "." matches "\n"

       Most of the time, the default behavior is what is wanted, but "/s" and "/m" are  occasionally
       very  useful.   If "/m" is being used, the start of the string can still be matched with "\A"
       and the end of the string can still be matched with the anchors "\Z" (matches  both  the  end
       and the newline before, like '$'), and "\z" (matches only the end):

           $x =~ /^Who/m;   # matches, "Who" at start of second line
           $x =~ /\AWho/m;  # doesn't match, "Who" is not at start of string

           $x =~ /girl$/m;  # matches, "girl" at end of first line
           $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string

           $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
           $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string

       We  now  know  how  to  create  choices  among classes of characters in a regexp.  What about
       choices among words or character strings? Such choices are described in the next section.

   Matching this or that
       Sometimes we would like our regexp to be able to match different possible words or  character
       strings.  This is accomplished by using the alternation metacharacter '|'.  To match "dog" or
       "cat",  we  form  the  regexp "dog|cat".  As before, Perl will try to match the regexp at the
       earliest possible point in the string.  At each character position, Perl will  first  try  to
       match  the  first  alternative,  "dog".   If "dog" doesn't match, Perl will then try the next
       alternative, "cat".  If "cat" doesn't match either, then the match fails and  Perl  moves  to
       the next position in the string.  Some examples:

           "cats and dogs" =~ /cat|dog|bird/;  # matches "cat"
           "cats and dogs" =~ /dog|cat|bird/;  # matches "cat"

       Even  though  "dog"  is  the  first  alternative in the second regexp, "cat" is able to match
       earlier in the string.

           "cats"          =~ /c|ca|cat|cats/; # matches "c"
           "cats"          =~ /cats|cat|ca|c/; # matches "cats"

       Here, all the alternatives match at the first string position, so the  first  alternative  is
       the  one  that  matches.   If some of the alternatives are truncations of the others, put the
       longest ones first to give them a chance to match.

           "cab" =~ /a|b|c/ # matches "c"
                            # /a|b|c/ == /[abc]/

       The last example points out that character classes are like alternations of characters.  At a
       given character position, the first alternative that allows the regexp match to succeed  will
       be the one that matches.

   Grouping things and hierarchical matching
       Alternation  allows  a regexp to choose among alternatives, but by itself it is unsatisfying.
       The reason is that each alternative is a whole regexp, but sometime we want alternatives  for
       just  part  of  a  regexp.   For  instance,  suppose  we  want  to  search  for  housecats or
       housekeepers.  The regexp "housecat|housekeeper" fits the bill, but is inefficient because we
       had to type "house" twice.  It would be nice to have parts of the regexp  be  constant,  like
       "house", and some parts have alternatives, like "cat|keeper".

       The grouping metacharacters "()" solve this problem.  Grouping allows parts of a regexp to be
       treated  as  a  single unit.  Parts of a regexp are grouped by enclosing them in parentheses.
       Thus we could solve the "housecat|housekeeper" by forming the  regexp  as  house(cat|keeper).
       The  regexp house(cat|keeper) means match "house" followed by either "cat" or "keeper".  Some
       more examples are

           /(a|b)b/;    # matches 'ab' or 'bb'
           /(ac|b)b/;   # matches 'acb' or 'bb'
           /(^a|b)c/;   # matches 'ac' at start of string or 'bc' anywhere
           /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'

           /house(cat|)/;  # matches either 'housecat' or 'house'
           /house(cat(s|)|)/;  # matches either 'housecats' or 'housecat' or
                               # 'house'.  Note groups can be nested.

           /(19|20|)\d\d/;  # match years 19xx, 20xx, or the Y2K problem, xx
           "20" =~ /(19|20|)\d\d/;  # matches the null alternative '()\d\d',
                                    # because '20\d\d' can't match

       Alternations behave the same way in groups as out of them: at a given  string  position,  the
       leftmost alternative that allows the regexp to match is taken.  So in the last example at the
       first string position, "20" matches the second alternative, but there is nothing left over to
       match  the  next  two  digits "\d\d".  So Perl moves on to the next alternative, which is the
       null alternative and that works, since "20" is two digits.

       The process of trying one alternative, seeing if it  matches,  and  moving  on  to  the  next
       alternative, while going back in the string from where the previous alternative was tried, if
       it  doesn't,  is  called  backtracking.   The  term  "backtracking"  comes from the idea that
       matching a regexp is like a walk in the  woods.   Successfully  matching  a  regexp  is  like
       arriving at a destination.  There are many possible trailheads, one for each string position,
       and  each one is tried in order, left to right.  From each trailhead there may be many paths,
       some of which get you there, and some which are dead ends.  When you walk along a  trail  and
       hit  a  dead  end,  you  have to backtrack along the trail to an earlier point to try another
       trail.  If you hit your destination, you stop immediately and forget  about  trying  all  the
       other  trails.   You  are  persistent, and only if you have tried all the trails from all the
       trailheads and not arrived at your destination, do you declare failure.  To be concrete, here
       is a step-by-step analysis of what Perl does when it tries to match the regexp

           "abcde" =~ /(abd|abc)(df|d|de)/;

       1.  Start with the first letter in the string 'a'.

       2.  Try the first alternative in the first group 'abd'.

       3.  Match 'a' followed by 'b'. So far so good.

       4.  'd' in the regexp doesn't match 'c' in the  string  -  a  dead  end.   So  backtrack  two
           characters and pick the second alternative in the first group 'abc'.

       5.  Match 'a' followed by 'b' followed by 'c'.  We are on a roll and have satisfied the first
           group. Set $1 to 'abc'.

       6.  Move on to the second group and pick the first alternative 'df'.

       7.  Match the 'd'.

       8.  'f'  in  the  regexp  doesn't  match  'e'  in  the  string, so a dead end.  Backtrack one
           character and pick the second alternative in the second group 'd'.

       9.  'd' matches. The second grouping is satisfied, so set $2 to 'd'.

       10. We are at the end of the regexp, so we are done! We have matched 'abcd' out of the string
           "abcde".

       There are a couple of things to note about this analysis.  First, the  third  alternative  in
       the  second  group  'de' also allows a match, but we stopped before we got to it - at a given
       character position, leftmost wins.  Second, we  were  able  to  get  a  match  at  the  first
       character  position  of the string 'a'.  If there were no matches at the first position, Perl
       would move to the second character position 'b' and attempt the match all over  again.   Only
       when  all  possible  paths  at all possible character positions have been exhausted does Perl
       give up and declare "$string =~ /(abd|abc)(df|d|de)/;" to be false.

       Even with all this work, regexp matching happens remarkably fast.  To speed things  up,  Perl
       compiles  the regexp into a compact sequence of opcodes that can often fit inside a processor
       cache.  When the code is executed, these opcodes can then run at  full  throttle  and  search
       very quickly.

   Extracting matches
       The grouping metacharacters "()" also serve another completely different function: they allow
       the  extraction  of the parts of a string that matched.  This is very useful to find out what
       matched and for text processing in general.  For each grouping, the part that matched  inside
       goes into the special variables $1, $2, etc.  They can be used just as ordinary variables:

           # extract hours, minutes, seconds
           if ($time =~ /(\d\d):(\d\d):(\d\d)/) {    # match hh:mm:ss format
               $hours = $1;
               $minutes = $2;
               $seconds = $3;
           }

       Now,  we  know  that  in  scalar context, "$time =~ /(\d\d):(\d\d):(\d\d)/" returns a true or
       false value.  In list context, however, it returns the list of matched  values  "($1,$2,$3)".
       So we could write the code more compactly as

           # extract hours, minutes, seconds
           ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);

       If  the  groupings  in  a  regexp  are  nested,  $1  gets the group with the leftmost opening
       parenthesis, $2 the next opening parenthesis, etc.  Here is a regexp with nested groups:

           /(ab(cd|ef)((gi)|j))/;
            1  2      34

       If this regexp matches, $1 contains a string starting with 'ab', $2 is either set to 'cd'  or
       'ef', $3 equals either 'gi' or 'j', and $4 is either set to 'gi', just like $3, or it remains
       undefined.

       For  convenience, Perl sets $+ to the string held by the highest numbered $1, $2,... that got
       assigned (and, somewhat related, $^N to the value of the $1, $2,...  most-recently  assigned;
       i.e. the $1, $2,... associated with the rightmost closing parenthesis used in the match).

   Backreferences
       Closely  associated  with  the  matching  variables $1, $2, ... are the backreferences "\g1",
       "\g2",...  Backreferences are simply matching variables that can be  used  inside  a  regexp.
       This  is  a  really  nice  feature;  what matches later in a regexp is made to depend on what
       matched earlier in the regexp.  Suppose we wanted to look for doubled words in a  text,  like
       "the the".  The following regexp finds all 3-letter doubles with a space in between:

           /\b(\w\w\w)\s\g1\b/;

       The  grouping  assigns  a value to "\g1", so that the same 3-letter sequence is used for both
       parts.

       A similar task is to find words consisting of two identical parts:

           % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\g1$' /usr/dict/words
           beriberi
           booboo
           coco
           mama
           murmur
           papa

       The regexp has a  single  grouping  which  considers  4-letter  combinations,  then  3-letter
       combinations, etc., and uses "\g1" to look for a repeat.  Although $1 and "\g1" represent the
       same  thing,  care  should be taken to use matched variables $1, $2,... only outside a regexp
       and backreferences "\g1", "\g2",... only inside a regexp; not doing so may lead to surprising
       and unsatisfactory results.

   Relative backreferences
       Counting the opening parentheses to get the correct number for a backreference is error-prone
       as soon as there is more than one  capturing  group.   A  more  convenient  technique  became
       available  with  Perl  5.10:  relative  backreferences. To refer to the immediately preceding
       capture group one now may write "\g-1" or "\g{-1}", the next but last is available via "\g-2"
       or "\g{-2}", and so on.

       Another good reason in  addition  to  readability  and  maintainability  for  using  relative
       backreferences  is  illustrated by the following example, where a simple pattern for matching
       peculiar strings is used:

           $a99a = '([a-z])(\d)\g2\g1';   # matches a11a, g22g, x33x, etc.

       Now that we have this pattern stored as a handy string, we might feel tempted to use it as  a
       part of some other pattern:

           $line = "code=e99e";
           if ($line =~ /^(\w+)=$a99a$/){   # unexpected behavior!
               print "$1 is valid\n";
           } else {
               print "bad line: '$line'\n";
           }

       But  this  doesn't  match,  at  least  not the way one might expect. Only after inserting the
       interpolated $a99a and looking at the resulting full text of the regexp is  it  obvious  that
       the  backreferences  have  backfired.  The  subexpression  "(\w+)"  has snatched number 1 and
       demoted  the  groups  in  $a99a  by  one  rank.  This  can  be  avoided  by  using   relative
       backreferences:

           $a99a = '([a-z])(\d)\g{-1}\g{-2}';  # safe for being interpolated

   Named backreferences
       Perl 5.10 also introduced named capture groups and named backreferences.  To attach a name to
       a  capturing group, you write either "(?<name>...)" or "(?'name'...)".  The backreference may
       then be written as "\g{name}".  It is permissible to attach the same name to  more  than  one
       group, but then only the leftmost one of the eponymous set can be referenced.  Outside of the
       pattern a named capture group is accessible through the "%+" hash.

       Assuming  that we have to match calendar dates which may be given in one of the three formats
       yyyy-mm-dd, mm/dd/yyyy or dd.mm.yyyy, we can write three suitable patterns where we use  'd',
       'm'  and 'y' respectively as the names of the groups capturing the pertaining components of a
       date. The matching operation combines the three patterns as alternatives:

           $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
           $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
           $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
           for my $d (qw(2006-10-21 15.01.2007 10/31/2005)) {
               if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
                   print "day=$+{d} month=$+{m} year=$+{y}\n";
               }
           }

       If any of the alternatives matches, the hash "%+" is bound to  contain  the  three  key-value
       pairs.

   Alternative capture group numbering
       Yet  another  capturing  group  numbering  technique  (also as from Perl 5.10) deals with the
       problem of referring to groups within a set of alternatives.  Consider a pattern for matching
       a time of the day, civil or military style:

           if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
               # process hour and minute
           }

       Processing the results requires an additional if statement to determine whether $1 and $2  or
       $3  and  $4  contain the goodies. It would be easier if we could use group numbers 1 and 2 in
       second alternative as well, and this is exactly what the parenthesized  construct  "(?|...)",
       set around an alternative achieves. Here is an extended version of the previous pattern:

         if($time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/){
             print "hour=$1 minute=$2 zone=$3\n";
         }

       Within  the  alternative  numbering  group, group numbers start at the same position for each
       alternative. After the group, numbering continues with one higher than  the  maximum  reached
       across all the alternatives.

   Position information
       In  addition  to  what  was  matched, Perl also provides the positions of what was matched as
       contents of the "@-" and "@+" arrays. "$-[0]" is the position of  the  start  of  the  entire
       match  and  $+[0] is the position of the end. Similarly, "$-[n]" is the position of the start
       of the $n match and $+[n] is the position of the end. If $n is undefined, so are "$-[n]"  and
       $+[n]. Then this code

           $x = "Mmm...donut, thought Homer";
           $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
           foreach $exp (1..$#-) {
               no strict 'refs';
               print "Match $exp: '$$exp' at position ($-[$exp],$+[$exp])\n";
           }

       prints

           Match 1: 'Mmm' at position (0,3)
           Match 2: 'donut' at position (6,11)

       Even  if  there  are  no groupings in a regexp, it is still possible to find out what exactly
       matched in a string.  If you use them, Perl will set "$`" to the part of  the  string  before
       the  match, will set $& to the part of the string that matched, and will set "$'" to the part
       of the string after the match.  An example:

           $x = "the cat caught the mouse";
           $x =~ /cat/;  # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
           $x =~ /the/;  # $` = '', $& = 'the', $' = ' cat caught the mouse'

       In the second match, "$`" equals ''  because  the  regexp  matched  at  the  first  character
       position in the string and stopped; it never saw the second "the".

       If  your  code  is  to  run on Perl versions earlier than 5.20, it is worthwhile to note that
       using "$`" and "$'" slows down regexp matching quite a bit, while  $&  slows  it  down  to  a
       lesser  extent,  because  if they are used in one regexp in a program, they are generated for
       all regexps in the program.  So if raw performance is a goal of your application, they should
       be avoided.  If you need to extract the corresponding substrings, use "@-" and "@+" instead:

           $` is the same as substr( $x, 0, $-[0] )
           $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
           $' is the same as substr( $x, $+[0] )

       As of Perl 5.10, the "${^PREMATCH}", "${^MATCH}" and "${^POSTMATCH}" variables may  be  used.
       These  are  only  set if the "/p" modifier is present.  Consequently they do not penalize the
       rest of the program.  In Perl  5.20,  "${^PREMATCH}",  "${^MATCH}"  and  "${^POSTMATCH}"  are
       available whether the "/p" has been used or not (the modifier is ignored), and "$`", "$'" and
       $& do not cause any speed difference.

   Non-capturing groupings
       A  group  that  is  required  to  bundle  a set of alternatives may or may not be useful as a
       capturing group.  If it isn't, it just creates a superfluous addition to the set of available
       capture group values, inside as well as outside the regexp.  Non-capturing groupings, denoted
       by "(?:regexp)", still allow the regexp to be treated as a single unit, but don't establish a
       capturing group at the same time.  Both capturing and non-capturing groupings are allowed  to
       co-exist  in  the  same  regexp.  Because there is no extraction, non-capturing groupings are
       faster than capturing groupings.  Non-capturing groupings are also handy for choosing exactly
       which parts of a regexp are to be extracted to matching variables:

           # match a number, $1-$4 are set, but we only want $1
           /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;

           # match a number faster , only $1 is set
           /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;

           # match a number, get $1 = whole number, $2 = exponent
           /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;

       Non-capturing groupings are also useful for removing nuisance elements gathered from a  split
       operation where parentheses are required for some reason:

           $x = '12aba34ba5';
           @num = split /(a|b)+/, $x;    # @num = ('12','a','34','a','5')
           @num = split /(?:a|b)+/, $x;  # @num = ('12','34','5')

       In  Perl  5.22 and later, all groups within a regexp can be set to non-capturing by using the
       new "/n" flag:

           "hello" =~ /(hi|hello)/n; # $1 is not set!

       See "n" in perlre for more information.

   Matching repetitions
       The examples in the previous section display an annoying weakness.   We  were  only  matching
       3-letter words, or chunks of words of 4 letters or less.  We'd like to be able to match words
       or,  more  generally,  strings  of  any length, without writing out tedious alternatives like
       "\w\w\w\w|\w\w\w|\w\w|\w".

       This is exactly the problem the quantifier  metacharacters  '?',  '*',  '+',  and  "{}"  were
       created  for.   They  allow  us to delimit the number of repeats for a portion of a regexp we
       consider to be a match.  Quantifiers are  put  immediately  after  the  character,  character
       class, or grouping that we want to specify.  They have the following meanings:

       •   "a?" means: match 'a' 1 or 0 times

       •   "a*" means: match 'a' 0 or more times, i.e., any number of times

       •   "a+" means: match 'a' 1 or more times, i.e., at least once

       •   "a{n,m}" means: match at least "n" times, but not more than "m" times.

       •   "a{n,}" means: match at least "n" or more times

       •   "a{,n}" means: match at most "n" times, or fewer

       •   "a{n}" means: match exactly "n" times

       If  you like, you can add blanks (tab or space characters) within the braces, but adjacent to
       them, and/or next to the comma (if any).

       Here are some examples:

           /[a-z]+\s+\d*/;  # match a lowercase word, at least one space, and
                            # any number of digits
           /(\w+)\s+\g1/;    # match doubled words of arbitrary length
           /y(es)?/i;       # matches 'y', 'Y', or a case-insensitive 'yes'
           $year =~ /^\d{2,4}$/;  # make sure year is at least 2 but not more
                                  # than 4 digits
           $year =~ /^\d{ 2, 4 }$/;    # Same; for those who like wide open
                                       # spaces.
           $year =~ /^\d{2, 4}$/;      # Same.
           $year =~ /^\d{4}$|^\d{2}$/; # better match; throw out 3-digit dates
           $year =~ /^\d{2}(\d{2})?$/; # same thing written differently.
                                       # However, this captures the last two
                                       # digits in $1 and the other does not.

           % simple_grep '^(\w+)\g1$' /usr/dict/words   # isn't this easier?
           beriberi
           booboo
           coco
           mama
           murmur
           papa

       For all of these quantifiers, Perl will try to match as much of the string as possible, while
       still allowing the regexp to succeed.  Thus with "/a?.../", Perl will first try to match  the
       regexp with the 'a' present; if that fails, Perl will try to match the regexp without the 'a'
       present.  For the quantifier '*', we get the following:

           $x = "the cat in the hat";
           $x =~ /^(.*)(cat)(.*)$/; # matches,
                                    # $1 = 'the '
                                    # $2 = 'cat'
                                    # $3 = ' in the hat'

       Which  is  what  we might expect, the match finds the only "cat" in the string and locks onto
       it.  Consider, however, this regexp:

           $x =~ /^(.*)(at)(.*)$/; # matches,
                                   # $1 = 'the cat in the h'
                                   # $2 = 'at'
                                   # $3 = ''   (0 characters match)

       One might initially guess that Perl would find the "at" in "cat" and  stop  there,  but  that
       wouldn't  give  the longest possible string to the first quantifier ".*".  Instead, the first
       quantifier ".*" grabs as much of the string as possible while still having the regexp  match.
       In  this example, that means having the "at" sequence with the final "at" in the string.  The
       other important principle illustrated here is that, when there are two or more elements in  a
       regexp,  the  leftmost  quantifier,  if  there  is one, gets to grab as much of the string as
       possible, leaving the rest of the regexp to fight over scraps.   Thus  in  our  example,  the
       first  quantifier  ".*"  grabs  most of the string, while the second quantifier ".*" gets the
       empty string.   Quantifiers that grab as much of the string as possible  are  called  maximal
       match or greedy quantifiers.

       When  a  regexp can match a string in several different ways, we can use the principles above
       to predict which way the regexp will match:

       •   Principle 0: Taken as a whole, any regexp  will  be  matched  at  the  earliest  possible
           position in the string.

       •   Principle  1:  In an alternation "a|b|c...", the leftmost alternative that allows a match
           for the whole regexp will be the one used.

       •   Principle 2: The maximal matching quantifiers '?', '*', '+' and "{n,m}" will  in  general
           match as much of the string as possible while still allowing the whole regexp to match.

       •   Principle  3:  If  there  are  two  or  more  elements  in  a regexp, the leftmost greedy
           quantifier, if any, will match as much of the string as possible while still allowing the
           whole regexp to match.  The next leftmost greedy quantifier, if any, will try to match as
           much of the string remaining available to it as possible, while still allowing the  whole
           regexp to match.  And so on, until all the regexp elements are satisfied.

       As  we have seen above, Principle 0 overrides the others. The regexp will be matched as early
       as possible, with the other principles determining how the regexp matches  at  that  earliest
       character position.

       Here is an example of these principles in action:

           $x = "The programming republic of Perl";
           $x =~ /^(.+)(e|r)(.*)$/;  # matches,
                                     # $1 = 'The programming republic of Pe'
                                     # $2 = 'r'
                                     # $3 = 'l'

       This  regexp  matches  at the earliest string position, 'T'.  One might think that 'e', being
       leftmost in the alternation, would be matched, but 'r' produces the  longest  string  in  the
       first quantifier.

           $x =~ /(m{1,2})(.*)$/;  # matches,
                                   # $1 = 'mm'
                                   # $2 = 'ing republic of Perl'

       Here, The earliest possible match is at the first 'm' in "programming". "m{1,2}" is the first
       quantifier, so it gets to match a maximal "mm".

           $x =~ /.*(m{1,2})(.*)$/;  # matches,
                                     # $1 = 'm'
                                     # $2 = 'ing republic of Perl'

       Here,  the regexp matches at the start of the string. The first quantifier ".*" grabs as much
       as possible, leaving just a single 'm' for the second quantifier "m{1,2}".

           $x =~ /(.?)(m{1,2})(.*)$/;  # matches,
                                       # $1 = 'a'
                                       # $2 = 'mm'
                                       # $3 = 'ing republic of Perl'

       Here, ".?" eats its maximal one character at the earliest possible position  in  the  string,
       'a' in "programming", leaving "m{1,2}" the opportunity to match both 'm''s. Finally,

           "aXXXb" =~ /(X*)/; # matches with $1 = ''

       because  it  can  match zero copies of 'X' at the beginning of the string.  If you definitely
       want to match at least one 'X', use "X+", not "X*".

       Sometimes greed is not good.  At times, we would like quantifiers to match a minimal piece of
       string, rather than a maximal piece.  For this purpose, Larry Wall created the minimal  match
       or  non-greedy quantifiers "??", "*?", "+?", and "{}?".  These are the usual quantifiers with
       a '?' appended to them.  They have the following meanings:

       •   "a??" means: match 'a' 0 or 1 times. Try 0 first, then 1.

       •   "a*?" means: match 'a' 0 or more times, i.e., any number of times, but as  few  times  as
           possible

       •   "a+?" means: match 'a' 1 or more times, i.e., at least once, but as few times as possible

       •   "a{n,m}?"  means:  match  at  least  "n"  times, not more than "m" times, as few times as
           possible

       •   "a{n,}?" means: match at least "n" times, but as few times as possible

       •   "a{,n}?" means: match at most "n" times, but as few times as possible

       •   "a{n}?" means: match exactly "n" times.  Because we match exactly "n" times,  "a{n}?"  is
           equivalent to "a{n}" and is just there for notational consistency.

       Let's look at the example above, but with minimal quantifiers:

           $x = "The programming republic of Perl";
           $x =~ /^(.+?)(e|r)(.*)$/; # matches,
                                     # $1 = 'Th'
                                     # $2 = 'e'
                                     # $3 = ' programming republic of Perl'

       The  minimal  string  that will allow both the start of the string '^' and the alternation to
       match is "Th", with the alternation "e|r" matching 'e'.  The second quantifier ".*"  is  free
       to gobble up the rest of the string.

           $x =~ /(m{1,2}?)(.*?)$/;  # matches,
                                     # $1 = 'm'
                                     # $2 = 'ming republic of Perl'

       The first string position that this regexp can match is at the first 'm' in "programming". At
       this  position,  the minimal "m{1,2}?"  matches just one 'm'.  Although the second quantifier
       ".*?" would prefer to match no characters, it is constrained by the end-of-string anchor  '$'
       to match the rest of the string.

           $x =~ /(.*?)(m{1,2}?)(.*)$/;  # matches,
                                         # $1 = 'The progra'
                                         # $2 = 'm'
                                         # $3 = 'ming republic of Perl'

       In  this  regexp,  you  might  expect  the first minimal quantifier ".*?"  to match the empty
       string, because it is not constrained by a '^' anchor to match the  beginning  of  the  word.
       Principle  0  applies here, however.  Because it is possible for the whole regexp to match at
       the start of the string, it will match at the start of the string.  Thus the first quantifier
       has to match everything up to the first 'm'.  The second minimal quantifier matches just  one
       'm' and the third quantifier matches the rest of the string.

           $x =~ /(.??)(m{1,2})(.*)$/;  # matches,
                                        # $1 = 'a'
                                        # $2 = 'mm'
                                        # $3 = 'ing republic of Perl'

       Just  as  in  the  previous regexp, the first quantifier ".??" can match earliest at position
       'a', so it does.  The second quantifier is greedy, so it matches "mm", and the third  matches
       the rest of the string.

       We can modify principle 3 above to take into account non-greedy quantifiers:

       •   Principle  3:  If  there  are two or more elements in a regexp, the leftmost greedy (non-
           greedy) quantifier, if any, will match as much (little) of the string as  possible  while
           still  allowing  the  whole  regexp  to  match.   The  next  leftmost greedy (non-greedy)
           quantifier, if any, will try to match as much (little) of the string remaining  available
           to  it as possible, while still allowing the whole regexp to match.  And so on, until all
           the regexp elements are satisfied.

       Just like alternation, quantifiers are also susceptible to backtracking.  Here is a  step-by-
       step analysis of the example

           $x = "the cat in the hat";
           $x =~ /^(.*)(at)(.*)$/; # matches,
                                   # $1 = 'the cat in the h'
                                   # $2 = 'at'
                                   # $3 = ''   (0 matches)

       1.  Start with the first letter in the string 't'.

       2.  The first quantifier '.*' starts out by matching the whole string "the cat in the hat".

       3.  'a'  in  the  regexp  element  'at'  doesn't  match the end of the string.  Backtrack one
           character.

       4.  'a' in the regexp element 'at' still doesn't match the last letter of the string 't',  so
           backtrack one more character.

       5.  Now we can match the 'a' and the 't'.

       6.  Move  on  to  the third element '.*'.  Since we are at the end of the string and '.*' can
           match 0 times, assign it the empty string.

       7.  We are done!

       Most of the time, all this moving forward and backtracking happens quickly and  searching  is
       fast.  There are some pathological regexps, however, whose execution time exponentially grows
       with the size of the string.  A typical structure that blows up in your face is of the form

           /(a|b+)*/;

       The problem is the nested indeterminate  quantifiers.   There  are  many  different  ways  of
       partitioning a string of length n between the '+' and '*': one repetition with "b+" of length
       n, two repetitions with the first "b+" length k and the second with length n-k, m repetitions
       whose  bits  add  up  to  length  n, etc.  In fact there are an exponential number of ways to
       partition a string as a function of its length.  A regexp may get lucky and  match  early  in
       the  process, but if there is no match, Perl will try every possibility before giving up.  So
       be careful with nested '*''s, "{n,m}"'s, and '+''s.  The book Mastering  Regular  Expressions
       by Jeffrey Friedl gives a wonderful discussion of this and other efficiency issues.

   Possessive quantifiers
       Backtracking  during  the  relentless search for a match may be a waste of time, particularly
       when the match is bound to fail.  Consider the simple pattern

           /^\w+\s+\w+$/; # a word, spaces, a word

       Whenever this is applied to a string which doesn't quite meet the pattern's expectations such
       as "abc  " or "abc  def ", the regexp engine will  backtrack,  approximately  once  for  each
       character  in  the string.  But we know that there is no way around taking all of the initial
       word characters to match the first repetition, that all spaces must be eaten  by  the  middle
       part, and the same goes for the second word.

       With  the  introduction  of  the  possessive  quantifiers  in  Perl  5.10,  we  have a way of
       instructing the regexp engine not to  backtrack,  with  the  usual  quantifiers  with  a  '+'
       appended  to  them.   This  makes them greedy as well as stingy; once they succeed they won't
       give anything back to permit another solution. They have the following meanings:

       •   "a{n,m}+" means: match at least "n" times, not more than "m"  times,  as  many  times  as
           possible, and don't give anything up. "a?+" is short for "a{0,1}+"

       •   "a{n,}+"  means:  match at least "n" times, but as many times as possible, and don't give
           anything up. "a++" is short for "a{1,}+".

       •   "a{,n}+" means: match as many times as possible up to at most "n" times, and  don't  give
           anything up. "a*+" is short for "a{0,}+".

       •   "a{n}+" means: match exactly "n" times.  It is just there for notational consistency.

       These  possessive  quantifiers  represent  a  special  case  of  a  more general concept, the
       independent subexpression, see below.

       As an example where a possessive quantifier is suitable we consider matching a quoted string,
       as it appears in several programming languages.  The backslash is used as an escape character
       that indicates that the next character is to be taken literally, as another character for the
       string.  Therefore, after the opening  quote,  we  expect  a  (possibly  empty)  sequence  of
       alternatives:  either  some  character  except  an unescaped quote or backslash or an escaped
       character.

           /"(?:[^"\\]++|\\.)*+"/;

   Building a regexp
       At this point, we have all the basic regexp concepts covered, so let's give a  more  involved
       example of a regular expression.  We will build a regexp that matches numbers.

       The  first  task  in building a regexp is to decide what we want to match and what we want to
       exclude.  In our case, we want to match both integers and floating point numbers and we  want
       to reject any string that isn't a number.

       The  next  task  is to break the problem down into smaller problems that are easily converted
       into a regexp.

       The simplest case is integers.  These consist of a sequence of digits, with an optional  sign
       in  front.   The  digits we can represent with "\d+" and the sign can be matched with "[+-]".
       Thus the integer regexp is

           /[+-]?\d+/;  # matches integers

       A floating point number potentially has  a  sign,  an  integral  part,  a  decimal  point,  a
       fractional  part,  and  an  exponent.   One or more of these parts is optional, so we need to
       check out the different possibilities.  Floating point  numbers  which  are  in  proper  form
       include  123.,  0.345,  .34,  -1e6,  and  25.4E-72.   As with integers, the sign out front is
       completely optional and can be matched by "[+-]?".  We can see that if there is no  exponent,
       floating  point  numbers must have a decimal point, otherwise they are integers.  We might be
       tempted to model these with "\d*\.\d*", but this would  also  match  just  a  single  decimal
       point,  which  is not a number.  So the three cases of floating point number without exponent
       are

          /[+-]?\d+\./;  # 1., 321., etc.
          /[+-]?\.\d+/;  # .1, .234, etc.
          /[+-]?\d+\.\d+/;  # 1.0, 30.56, etc.

       These can be combined into a single regexp with a three-way alternation:

          /[+-]?(\d+\.\d+|\d+\.|\.\d+)/;  # floating point, no exponent

       In this alternation, it is important to put  '\d+\.\d+'  before  '\d+\.'.   If  '\d+\.'  were
       first, the regexp would happily match that and ignore the fractional part of the number.

       Now  consider  floating  point numbers with exponents.  The key observation here is that both
       integers and numbers with  decimal  points  are  allowed  in  front  of  an  exponent.   Then
       exponents,  like the overall sign, are independent of whether we are matching numbers with or
       without decimal points, and can be "decoupled" from the mantissa.  The overall  form  of  the
       regexp now becomes clear:

           /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;

       The exponent is an 'e' or 'E', followed by an integer.  So the exponent regexp is

          /[eE][+-]?\d+/;  # exponent

       Putting all the parts together, we get a regexp that matches numbers:

          /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/;  # Ta da!

       Long  regexps  like  this  may impress your friends, but can be hard to decipher.  In complex
       situations like this, the "/x" modifier for a match is invaluable.   It  allows  one  to  put
       nearly  arbitrary  whitespace  and  comments  into  a regexp without affecting their meaning.
       Using it, we can rewrite our "extended" regexp in the more pleasing form

          /^
             [+-]?         # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+\.\d+  # mantissa of the form a.b
                |\d+\.     # mantissa of the form a.
                |\.\d+     # mantissa of the form .b
                |\d+       # integer of the form a
             )
             ( [eE] [+-]? \d+ )?  # finally, optionally match an exponent
          $/x;

       If whitespace is mostly irrelevant, how does one include  space  characters  in  an  extended
       regexp?  The  answer  is to backslash it '\ ' or put it in a character class "[ ]".  The same
       thing goes for pound signs: use "\#" or "[#]".  For instance, Perl allows a space between the
       sign and the mantissa or integer, and we could add this to our regexp as follows:

          /^
             [+-]?\ *      # first, match an optional sign *and space*
             (             # then match integers or f.p. mantissas:
                 \d+\.\d+  # mantissa of the form a.b
                |\d+\.     # mantissa of the form a.
                |\.\d+     # mantissa of the form .b
                |\d+       # integer of the form a
             )
             ( [eE] [+-]? \d+ )?  # finally, optionally match an exponent
          $/x;

       In this form, it is easier to see a way to simplify the alternation.  Alternatives 1, 2,  and
       4 all start with "\d+", so it could be factored out:

          /^
             [+-]?\ *      # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+       # start out with a ...
                 (
                     \.\d* # mantissa of the form a.b or a.
                 )?        # ? takes care of integers of the form a
                |\.\d+     # mantissa of the form .b
             )
             ( [eE] [+-]? \d+ )?  # finally, optionally match an exponent
          $/x;

       Starting  in  Perl v5.26, specifying "/xx" changes the square-bracketed portions of a pattern
       to ignore tabs and space characters  unless  they  are  escaped  by  preceding  them  with  a
       backslash.  So, we could write

          /^
             [ + - ]?\ *   # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+       # start out with a ...
                 (
                     \.\d* # mantissa of the form a.b or a.
                 )?        # ? takes care of integers of the form a
                |\.\d+     # mantissa of the form .b
             )
             ( [ e E ] [ + - ]? \d+ )?  # finally, optionally match an exponent
          $/xx;

       This  doesn't  really  improve the legibility of this example, but it's available in case you
       want it.  Squashing the pattern down to the compact form, we have

           /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;

       This is our final regexp.  To recap, we built a regexp by

       •   specifying the task in detail,

       •   breaking down the problem into smaller parts,

       •   translating the small parts into regexps,

       •   combining the regexps,

       •   and optimizing the final combined regexp.

       These are also the typical steps involved in writing a computer program.  This makes  perfect
       sense,  because  regular  expressions  are  essentially programs written in a little computer
       language that specifies patterns.

   Using regular expressions in Perl
       The last topic of Part 1 briefly covers how regexps are used in Perl programs.  Where do they
       fit into Perl syntax?

       We have already introduced the matching operator in  its  default  "/regexp/"  and  arbitrary
       delimiter "m!regexp!" forms.  We have used the binding operator "=~" and its negation "!~" to
       test for string matches.  Associated with the matching operator, we have discussed the single
       line  "/s",  multi-line "/m", case-insensitive "/i" and extended "/x" modifiers.  There are a
       few more things you might want to know about matching operators.

       Prohibiting substitution

       If you change $pattern after the first substitution happens, Perl will  ignore  it.   If  you
       don't want any substitutions at all, use the special delimiter "m''":

           @pattern = ('Seuss');
           while (<>) {
               print if m'@pattern';  # matches literal '@pattern', not 'Seuss'
           }

       Similar  to  strings,  "m''"  acts like apostrophes on a regexp; all other 'm' delimiters act
       like quotes.  If the regexp evaluates to the empty string, the regexp in the last  successful
       match is used instead.  So we have

           "dog" =~ /d/;  # 'd' matches
           "dogbert" =~ //;  # this matches the 'd' regexp used before

       Global matching

       The  final  two modifiers we will discuss here, "/g" and "/c", concern multiple matches.  The
       modifier "/g" stands for global matching and allows the matching operator to match  within  a
       string as many times as possible.  In scalar context, successive invocations against a string
       will  have  "/g" jump from match to match, keeping track of position in the string as it goes
       along.  You can get or set the position with the pos() function.

       The use of "/g" is shown in the following example.  Suppose we have a string that consists of
       words separated by spaces.  If we know how many words there are in advance, we could  extract
       the words using groupings:

           $x = "cat dog house"; # 3 words
           $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
                                                  # $1 = 'cat'
                                                  # $2 = 'dog'
                                                  # $3 = 'house'

       But  what  if we had an indeterminate number of words? This is the sort of task "/g" was made
       for.  To extract all words, form the simple regexp "(\w+)" and loop  over  all  matches  with
       "/(\w+)/g":

           while ($x =~ /(\w+)/g) {
               print "Word is $1, ends at position ", pos $x, "\n";
           }

       prints

           Word is cat, ends at position 3
           Word is dog, ends at position 7
           Word is house, ends at position 13

       A  failed  match  or  changing  the target string resets the position.  If you don't want the
       position reset after failure to match,  add  the  "/c",  as  in  "/regexp/gc".   The  current
       position  in  the  string  is  associated  with  the string, not the regexp.  This means that
       different strings have different positions and their respective positions can be set or  read
       independently.

       In  list  context,  "/g" returns a list of matched groupings, or if there are no groupings, a
       list of matches to the whole regexp.  So if we wanted just the words, we could use

           @words = ($x =~ /(\w+)/g);  # matches,
                                       # $words[0] = 'cat'
                                       # $words[1] = 'dog'
                                       # $words[2] = 'house'

       Closely associated with the "/g" modifier is the "\G" anchor.  The "\G" anchor matches at the
       point where the previous "/g" match left off.  "\G" allows us to easily do  context-sensitive
       matching:

           $metric = 1;  # use metric units
           ...
           $x = <FILE>;  # read in measurement
           $x =~ /^([+-]?\d+)\s*/g;  # get magnitude
           $weight = $1;
           if ($metric) { # error checking
               print "Units error!" unless $x =~ /\Gkg\./g;
           }
           else {
               print "Units error!" unless $x =~ /\Glbs\./g;
           }
           $x =~ /\G\s+(widget|sprocket)/g;  # continue processing

       The  combination  of  "/g"  and  "\G" allows us to process the string a bit at a time and use
       arbitrary Perl logic to decide what to do next.  Currently, the "\G"  anchor  is  only  fully
       supported when used to anchor to the start of the pattern.

       "\G"  is  also invaluable in processing fixed-length records with regexps.  Suppose we have a
       snippet of coding region DNA, encoded as base pair letters "ATCGTTGAAT..."  and  we  want  to
       find all the stop codons "TGA".  In a coding region, codons are 3-letter sequences, so we can
       think of the DNA snippet as a sequence of 3-letter records.  The naive regexp

           # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
           $dna = "ATCGTTGAATGCAAATGACATGAC";
           $dna =~ /TGA/;

       doesn't  work; it may match a "TGA", but there is no guarantee that the match is aligned with
       codon boundaries, e.g., the substring "GTT GAA" gives a match.  A better solution is

           while ($dna =~ /(\w\w\w)*?TGA/g) {  # note the minimal *?
               print "Got a TGA stop codon at position ", pos $dna, "\n";
           }

       which prints

           Got a TGA stop codon at position 18
           Got a TGA stop codon at position 23

       Position 18 is good, but position 23 is bogus.  What happened?

       The answer is that our regexp works well until we get past the last  real  match.   Then  the
       regexp  will  fail  to  match  a  synchronized  "TGA"  and start stepping ahead one character
       position at a time, not what we want.  The solution is to use "\G" to anchor the match to the
       codon alignment:

           while ($dna =~ /\G(\w\w\w)*?TGA/g) {
               print "Got a TGA stop codon at position ", pos $dna, "\n";
           }

       This prints

           Got a TGA stop codon at position 18

       which is the correct answer.  This example illustrates that it is important not only to match
       what is desired, but to reject what is not desired.

       (There are other regexp modifiers that are available, such as  "/o",  but  their  specialized
       uses are beyond the scope of this introduction.  )

       Search and replace

       Regular  expressions  also  play a big role in search and replace operations in Perl.  Search
       and  replace  is  accomplished   with   the   "s///"   operator.    The   general   form   is
       "s/regexp/replacement/modifiers",  with  everything  we  know  about  regexps  and  modifiers
       applying in this case as well.  The replacement is a Perl double-quoted string that  replaces
       in  the string whatever is matched with the "regexp".  The operator "=~" is also used here to
       associate a string with "s///".  If matching against $_, the  "$_ =~"  can  be  dropped.   If
       there  is  a  match,  "s///"  returns  the number of substitutions made; otherwise it returns
       false.  Here are a few examples:

           $x = "Time to feed the cat!";
           $x =~ s/cat/hacker/;   # $x contains "Time to feed the hacker!"
           if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
               $more_insistent = 1;
           }
           $y = "'quoted words'";
           $y =~ s/^'(.*)'$/$1/;  # strip single quotes,
                                  # $y contains "quoted words"

       In the last example, the whole string was matched, but only the part inside the single quotes
       was grouped.  With the "s///" operator, the matched variables $1, $2,  etc.  are  immediately
       available  for  use  in the replacement expression, so we use $1 to replace the quoted string
       with just what was quoted.  With the global modifier, "s///g" will  search  and  replace  all
       occurrences of the regexp in the string:

           $x = "I batted 4 for 4";
           $x =~ s/4/four/;   # doesn't do it all:
                              # $x contains "I batted four for 4"
           $x = "I batted 4 for 4";
           $x =~ s/4/four/g;  # does it all:
                              # $x contains "I batted four for four"

       If  you prefer "regex" over "regexp" in this tutorial, you could use the following program to
       replace it:

           % cat > simple_replace
           #!/usr/bin/perl
           $regexp = shift;
           $replacement = shift;
           while (<>) {
               s/$regexp/$replacement/g;
               print;
           }
           ^D

           % simple_replace regexp regex perlretut.pod

       In "simple_replace" we used the "s///g" modifier to replace all occurrences of the regexp  on
       each  line.   (Even  though the regular expression appears in a loop, Perl is smart enough to
       compile   it   only   once.)    As   with   "simple_grep",   both   the   "print"   and   the
       "s/$regexp/$replacement/g" use $_ implicitly.

       If  you  don't  want  "s///" to change your original variable you can use the non-destructive
       substitute modifier, "s///r".  This changes the behavior so that "s///r"  returns  the  final
       substituted string (instead of the number of substitutions):

           $x = "I like dogs.";
           $y = $x =~ s/dogs/cats/r;
           print "$x $y\n";

       That  example  will print "I like dogs. I like cats". Notice the original $x variable has not
       been affected. The overall result of the  substitution  is  instead  stored  in  $y.  If  the
       substitution doesn't affect anything then the original string is returned:

           $x = "I like dogs.";
           $y = $x =~ s/elephants/cougars/r;
           print "$x $y\n"; # prints "I like dogs. I like dogs."

       One other interesting thing that the "s///r" flag allows is chaining substitutions:

           $x = "Cats are great.";
           print $x =~ s/Cats/Dogs/r =~ s/Dogs/Frogs/r =~
               s/Frogs/Hedgehogs/r, "\n";
           # prints "Hedgehogs are great."

       A  modifier  available specifically to search and replace is the "s///e" evaluation modifier.
       "s///e" treats the replacement text as Perl code, rather than a  double-quoted  string.   The
       value  that  the code returns is substituted for the matched substring.  "s///e" is useful if
       you need to do a bit of computation in the process of replacing text.   This  example  counts
       character frequencies in a line:

           $x = "Bill the cat";
           $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
           print "frequency of '$_' is $chars{$_}\n"
               foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);

       This prints

           frequency of ' ' is 2
           frequency of 't' is 2
           frequency of 'l' is 2
           frequency of 'B' is 1
           frequency of 'c' is 1
           frequency of 'e' is 1
           frequency of 'h' is 1
           frequency of 'i' is 1
           frequency of 'a' is 1

       As  with  the  match  "m//"  operator,  "s///"  can  use other delimiters, such as "s!!!" and
       "s{}{}", and even "s{}//".  If single quotes are used "s'''", then the regexp and replacement
       are treated as single-quoted strings and there are no variable substitutions.  "s///" in list
       context returns the same thing as in scalar context, i.e., the number of matches.

       The split function

       The split() function is another place where a  regexp  is  used.   "split  /regexp/,  string,
       limit"  separates  the "string" operand into a list of substrings and returns that list.  The
       regexp must be designed  to  match  whatever  constitutes  the  separators  for  the  desired
       substrings.   The  "limit", if present, constrains splitting into no more than "limit" number
       of strings.  For example, to split a string into words, use

           $x = "Calvin and Hobbes";
           @words = split /\s+/, $x;  # $word[0] = 'Calvin'
                                      # $word[1] = 'and'
                                      # $word[2] = 'Hobbes'

       If the empty regexp "//" is used, the regexp always matches and  the  string  is  split  into
       individual  characters.   If  the  regexp has groupings, then the resulting list contains the
       matched substrings from the groupings as well.  For instance,

           $x = "/usr/bin/perl";
           @dirs = split m!/!, $x;  # $dirs[0] = ''
                                    # $dirs[1] = 'usr'
                                    # $dirs[2] = 'bin'
                                    # $dirs[3] = 'perl'
           @parts = split m!(/)!, $x;  # $parts[0] = ''
                                       # $parts[1] = '/'
                                       # $parts[2] = 'usr'
                                       # $parts[3] = '/'
                                       # $parts[4] = 'bin'
                                       # $parts[5] = '/'
                                       # $parts[6] = 'perl'

       Since the first character of $x matched  the  regexp,  "split"  prepended  an  empty  initial
       element to the list.

       If  you  have  read this far, congratulations! You now have all the basic tools needed to use
       regular expressions to solve a wide range of text processing problems.  If this is your first
       time through the tutorial, why not stop here and play around with regexps a while....  Part 2
       concerns the more esoteric aspects of regular expressions and those concepts certainly aren't
       needed right at the start.

Part 2: Power tools
       OK, you know the basics  of  regexps  and  you  want  to  know  more.   If  matching  regular
       expressions  is  analogous  to  a  walk  in the woods, then the tools discussed in Part 1 are
       analogous to topo maps and a compass, basic tools we use all the time.  Most of the tools  in
       part  2  are  analogous  to flare guns and satellite phones.  They aren't used too often on a
       hike, but when we are stuck, they can be invaluable.

       What follows are the more advanced, less used, or sometimes  esoteric  capabilities  of  Perl
       regexps.   In  Part  2, we will assume you are comfortable with the basics and concentrate on
       the advanced features.

   More on characters, strings, and character classes
       There are a number of escape sequences and character classes that we haven't covered yet.

       There are several escape sequences that convert characters or strings between upper and lower
       case, and they are also available within patterns.  "\l" and "\u" convert the next  character
       to lower or upper case, respectively:

           $x = "perl";
           $string =~ /\u$x/;  # matches 'Perl' in $string
           $x = "M(rs?|s)\\."; # note the double backslash
           $string =~ /\l$x/;  # matches 'mr.', 'mrs.', and 'ms.',

       A  "\L"  or  "\U"  indicates a lasting conversion of case, until terminated by "\E" or thrown
       over by another "\U" or "\L":

           $x = "This word is in lower case:\L SHOUT\E";
           $x =~ /shout/;       # matches
           $x = "I STILL KEYPUNCH CARDS FOR MY 360";
           $x =~ /\Ukeypunch/;  # matches punch card string

       If there is no "\E", case is converted until the end of the string. The  regexps  "\L\u$word"
       or  "\u\L$word"  convert  the  first  character  of  $word  to  uppercase and the rest of the
       characters to lowercase.  (Beyond ASCII characters, it gets somewhat more  complicated;  "\u"
       actually  performs titlecase mapping, which for most characters is the same as uppercase, but
       not for all; see <https://unicode.org/faq/casemap_charprop.html#4>.)

       Control characters can be escaped with "\c", so that a control-Z character would  be  matched
       with  "\cZ".   The  escape  sequence  "\Q"..."\E"  quotes,  or  protects  most non-alphabetic
       characters.   For instance,

           $x = "\QThat !^*&%~& cat!";
           $x =~ /\Q!^*&%~&\E/;  # check for rough language

       It does not protect '$' or '@', so that variables can still be substituted.

       "\Q", "\L", "\l", "\U", "\u" and "\E" are actually part of  double-quotish  syntax,  and  not
       part of regexp syntax proper.  They will work if they appear in a regular expression embedded
       directly in a program, but not when contained in a string that is interpolated in a pattern.

       Perl  regexps  can  handle  more  than  just the standard ASCII character set.  Perl supports
       Unicode, a standard for representing the alphabets from virtually all of the world's  written
       languages,  and  a  host  of  symbols.   Perl's text strings are Unicode strings, so they can
       contain characters with a value (codepoint or character number) higher than 255.

       What does this mean for regexps? Well, regexp users don't need  to  know  much  about  Perl's
       internal  representation  of  strings.   But they do need to know 1) how to represent Unicode
       characters in a regexp and 2) that a matching operation will treat the string to be  searched
       as  a sequence of characters, not bytes.  The answer to 1) is that Unicode characters greater
       than chr(255) are represented using the "\x{hex}" notation,  because  "\x"XY  (without  curly
       braces  and  XY  are two hex digits) doesn't go further than 255.  (Starting in Perl 5.14, if
       you're an octal fan, you can also use "\o{oct}".)

           /\x{263a}/;   # match a Unicode smiley face :)
           /\x{ 263a }/; # Same

       NOTE: In Perl 5.6.0 it used to be that one needed to  say  "use  utf8"  to  use  any  Unicode
       features.  This is no longer the case: for almost all Unicode processing, the explicit "utf8"
       pragma  is  not needed.  (The only case where it matters is if your Perl script is in Unicode
       and encoded in UTF-8, then an explicit "use utf8" is needed.)

       Figuring out the hexadecimal sequence of a Unicode character you want or deciphering  someone
       else's  hexadecimal  Unicode  regexp is about as much fun as programming in machine code.  So
       another way to specify Unicode characters is to  use  the  named  character  escape  sequence
       "\N{name}".   name is a name for the Unicode character, as specified in the Unicode standard.
       For instance, if we wanted to represent  or  match  the  astrological  sign  for  the  planet
       Mercury, we could use

           $x = "abc\N{MERCURY}def";
           $x =~ /\N{MERCURY}/;   # matches
           $x =~ /\N{ MERCURY }/; # Also matches

       One can also use "short" names:

           print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
           print "\N{greek:Sigma} is an upper-case sigma.\n";

       You can also restrict names to a certain alphabet by specifying the charnames pragma:

           use charnames qw(greek);
           print "\N{sigma} is Greek sigma\n";

       An   index   of   character   names   is  available  on-line  from  the  Unicode  Consortium,
       <https://www.unicode.org/charts/charindex.html>; explanatory material  with  links  to  other
       resources at <https://www.unicode.org/standard/where>.

       Starting  in Perl v5.32, an alternative to "\N{...}" for full names is available, and that is
       to say

        /\p{Name=greek small letter sigma}/

       The casing of the character name is irrelevant when used  in  "\p{}",  as  are  most  spaces,
       underscores  and hyphens.  (A few outlier characters cause problems with ignoring all of them
       always.  The details (which you can look up when you get more proficient, and if ever needed)
       are in <https://www.unicode.org/reports/tr44/tr44-24.html#UAX44-LM2>).

       The answer to requirement 2) is that a regexp (mostly) uses Unicode characters.  The "mostly"
       is for messy backward compatibility reasons, but starting in Perl 5.14, any  regexp  compiled
       in  the  scope  of a "use feature 'unicode_strings'" (which is automatically turned on within
       the scope of a "use v5.12" or higher) will turn that "mostly" into "always".  If you want  to
       handle  Unicode properly, you should ensure that 'unicode_strings' is turned on.  Internally,
       this is encoded to bytes using either UTF-8 or a native 8  bit  encoding,  depending  on  the
       history  of  the  string,  but  conceptually  it  is a sequence of characters, not bytes. See
       perlunitut for a tutorial about that.

       Let us now discuss Unicode character classes, most  usually  called  "character  properties".
       These are represented by the "\p{name}" escape sequence.  The negation of this is "\P{name}".
       For example, to match lower and uppercase characters,

           $x = "BOB";
           $x =~ /^\p{IsUpper}/;   # matches, uppercase char class
           $x =~ /^\P{IsUpper}/;   # doesn't match, char class sans uppercase
           $x =~ /^\p{IsLower}/;   # doesn't match, lowercase char class
           $x =~ /^\P{IsLower}/;   # matches, char class sans lowercase

       (The ""Is"" is optional.)

       There are many, many Unicode character properties.  For the full list see perluniprops.  Most
       of  them  have  synonyms  with  shorter names, also listed there.  Some synonyms are a single
       character.  For these, you can drop the braces.  For instance, "\pM" is  the  same  thing  as
       "\p{Mark}", meaning things like accent marks.

       The  Unicode "\p{Script}" and "\p{Script_Extensions}" properties are used to categorize every
       Unicode character into the language script it is written in.  For example,  English,  French,
       and  a  bunch of other European languages are written in the Latin script.  But there is also
       the Greek script, the Thai script, the Katakana script, etc.  ("Script"  is  an  older,  less
       advanced,  form  of "Script_Extensions", retained only for backwards compatibility.)  You can
       test whether  a  character  is  in  a  particular  script   with,  for  example  "\p{Latin}",
       "\p{Greek}",  or  "\p{Katakana}".   To test if it isn't in the Balinese script, you would use
       "\P{Balinese}".  (These all use "Script_Extensions" under the  hood,  as  that  gives  better
       results.)

       What  we  have described so far is the single form of the "\p{...}" character classes.  There
       is also a compound form which  you  may  run  into.   These  look  like  "\p{name=value}"  or
       "\p{name:value}"  (the  equals  sign  and colon can be used interchangeably).  These are more
       general than the single form, and in fact most of the  single  forms  are  just  Perl-defined
       shortcuts  for  common  compound  forms.   For  example,  the script examples in the previous
       paragraph    could    be    written    equivalently     as     "\p{Script_Extensions=Latin}",
       "\p{Script_Extensions:Greek}",              "\p{script_extensions=katakana}",             and
       "\P{script_extensions=balinese}" (case is irrelevant between the "{}" braces).  You may never
       have to use the compound forms, but sometimes it is necessary, and their use  can  make  your
       code easier to understand.

       "\X"  is  an  abbreviation  for  a character class that comprises a Unicode extended grapheme
       cluster.  This represents a "logical character": what appears to be a single  character,  but
       may be represented internally by more than one.  As an example, using the Unicode full names,
       e.g.,  "A + COMBINING RING"  is  a  grapheme  cluster  with  base character "A" and combining
       character "COMBINING RING, which translates in Danish to "A" with the circle atop it,  as  in
       the word Ångstrom.

       For  the  full  and  latest information about Unicode see the latest Unicode standard, or the
       Unicode Consortium's website <https://www.unicode.org>

       As if all those classes weren't enough, Perl  also  defines  POSIX-style  character  classes.
       These have the form "[:name:]", with name the name of the POSIX class.  The POSIX classes are
       "alpha",  "alnum",  "ascii",  "cntrl",  "digit", "graph", "lower", "print", "punct", "space",
       "upper", and "xdigit", and two extensions, "word" (a  Perl  extension  to  match  "\w"),  and
       "blank"  (a  GNU extension).  The "/a" modifier restricts these to matching just in the ASCII
       range; otherwise they can match  the  same  as  their  corresponding  Perl  Unicode  classes:
       "[:upper:]"  is  the same as "\p{IsUpper}", etc.  (There are some exceptions and gotchas with
       this;  see  perlrecharclass  for  a  full  discussion.)  The  "[:digit:]",  "[:word:]",   and
       "[:space:]"  correspond  to the familiar "\d", "\w", and "\s" character classes.  To negate a
       POSIX class, put a '^' in front of the name, so that, e.g., "[:^digit:]" corresponds to  "\D"
       and,  under Unicode, "\P{IsDigit}".  The Unicode and POSIX character classes can be used just
       like "\d", with the exception that POSIX character classes can  only  be  used  inside  of  a
       character class:

           /\s+[abc[:digit:]xyz]\s*/;  # match a,b,c,x,y,z, or a digit
           /^=item\s[[:digit:]]/;      # match '=item',
                                       # followed by a space and a digit
           /\s+[abc\p{IsDigit}xyz]\s+/;  # match a,b,c,x,y,z, or a digit
           /^=item\s\p{IsDigit}/;        # match '=item',
                                         # followed by a space and a digit

       Whew! That is all the rest of the characters and character classes.

   Compiling and saving regular expressions
       In Part 1 we mentioned that Perl compiles a regexp into a compact sequence of opcodes.  Thus,
       a  compiled regexp is a data structure that can be stored once and used again and again.  The
       regexp quote "qr//" does exactly that: "qr/string/" compiles the "string"  as  a  regexp  and
       transforms the result into a form that can be assigned to a variable:

           $reg = qr/foo+bar?/;  # reg contains a compiled regexp

       Then $reg can be used as a regexp:

           $x = "fooooba";
           $x =~ $reg;     # matches, just like /foo+bar?/
           $x =~ /$reg/;   # same thing, alternate form

       $reg can also be interpolated into a larger regexp:

           $x =~ /(abc)?$reg/;  # still matches

       As  with  the matching operator, the regexp quote can use different delimiters, e.g., "qr!!",
       "qr{}" or "qr~~".  Apostrophes as delimiters ("qr''") inhibit any interpolation.

       Pre-compiled regexps are useful for creating dynamic matches that don't need to be recompiled
       each time they are encountered.  Using pre-compiled regexps, we write a  "grep_step"  program
       which greps for a sequence of patterns, advancing to the next pattern as soon as one has been
       satisfied.

           % cat > grep_step
           #!/usr/bin/perl
           # grep_step - match <number> regexps, one after the other
           # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);
           @compiled = map qr/$_/, @regexp;
           while ($line = <>) {
               if ($line =~ /$compiled[0]/) {
                   print $line;
                   shift @compiled;
                   last unless @compiled;
               }
           }
           ^D

           % grep_step 3 shift print last grep_step
           $number = shift;
                   print $line;
                   last unless @compiled;

       Storing  pre-compiled  regexps  in  an  array  @compiled allows us to simply loop through the
       regexps without any recompilation, thus gaining flexibility without sacrificing speed.

   Composing regular expressions at runtime
       Backtracking is more efficient than repeated tries with different  regular  expressions.   If
       there  are several regular expressions and a match with any of them is acceptable, then it is
       possible to combine them into a set of alternatives.  If the individual expressions are input
       data, this can be done by programming a join  operation.   We'll  exploit  this  idea  in  an
       improved version of the "simple_grep" program: a program that matches multiple patterns:

           % cat > multi_grep
           #!/usr/bin/perl
           # multi_grep - match any of <number> regexps
           # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);
           $pattern = join '|', @regexp;

           while ($line = <>) {
               print $line if $line =~ /$pattern/;
           }
           ^D

           % multi_grep 2 shift for multi_grep
           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);

       Sometimes it is advantageous to construct a pattern from the input that is to be analyzed and
       use  the  permissible values on the left hand side of the matching operations.  As an example
       for this somewhat paradoxical situation, let's assume that our input contains a command  verb
       which  should  match  one  out of a set of available command verbs, with the additional twist
       that commands may be abbreviated as long as the given string is  unique.  The  program  below
       demonstrates the basic algorithm.

           % cat > keymatch
           #!/usr/bin/perl
           $kwds = 'copy compare list print';
           while( $cmd = <> ){
               $cmd =~ s/^\s+|\s+$//g;  # trim leading and trailing spaces
               if( ( @matches = $kwds =~ /\b$cmd\w*/g ) == 1 ){
                   print "command: '@matches'\n";
               } elsif( @matches == 0 ){
                   print "no such command: '$cmd'\n";
               } else {
                   print "not unique: '$cmd' (could be one of: @matches)\n";
               }
           }
           ^D

           % keymatch
           li
           command: 'list'
           co
           not unique: 'co' (could be one of: copy compare)
           printer
           no such command: 'printer'

       Rather  than  trying  to  match  the input against the keywords, we match the combined set of
       keywords against the input.  The pattern matching  operation  "$kwds =~ /\b($cmd\w*)/g"  does
       several  things at the same time. It makes sure that the given command begins where a keyword
       begins ("\b"). It tolerates abbreviations due to the added "\w*". It tells us the  number  of
       matches  ("scalar  @matches")  and  all  the  keywords that were actually matched.  You could
       hardly ask for more.

   Embedding comments and modifiers in a regular expression
       Starting with this section, we will be discussing Perl's set of extended patterns.  These are
       extensions to the traditional regular expression syntax that provide powerful new  tools  for
       pattern  matching.   We  have  already  seen  extensions  in the form of the minimal matching
       constructs "??", "*?", "+?", "{n,m}?", "{n,}?", and "{,n}?".  Most of  the  extensions  below
       have  the  form  "(?char...)",  where  the  "char" is a character that determines the type of
       extension.

       The first extension is an embedded comment  "(?#text)".   This  embeds  a  comment  into  the
       regular  expression  without  affecting its meaning.  The comment should not have any closing
       parentheses in the text.  An example is

           /(?# Match an integer:)[+-]?\d+/;

       This style of commenting has been largely superseded by the raw, freeform commenting that  is
       allowed with the "/x" modifier.

       Most  modifiers,  such  as "/i", "/m", "/s" and "/x" (or any combination thereof) can also be
       embedded in a regexp using "(?i)", "(?m)", "(?s)", and "(?x)".  For instance,

           /(?i)yes/;  # match 'yes' case insensitively
           /yes/i;     # same thing
           /(?x)(          # freeform version of an integer regexp
                    [+-]?  # match an optional sign
                    \d+    # match a sequence of digits
                )
           /x;

       Embedded modifiers can have two important advantages  over  the  usual  modifiers.   Embedded
       modifiers  allow  a  custom  set  of  modifiers  for  each regexp pattern.  This is great for
       matching an array of regexps that must have different modifiers:

           $pattern[0] = '(?i)doctor';
           $pattern[1] = 'Johnson';
           ...
           while (<>) {
               foreach $patt (@pattern) {
                   print if /$patt/;
               }
           }

       The second advantage is that embedded modifiers  (except  "/p",  which  modifies  the  entire
       regexp)  only  affect  the regexp inside the group the embedded modifier is contained in.  So
       grouping can be used to localize the modifier's effects:

           /Answer: ((?i)yes)/;  # matches 'Answer: yes', 'Answer: YES', etc.

       Embedded modifiers can also turn off any modifiers already present by using,  e.g.,  "(?-i)".
       Modifiers  can also be combined into a single expression, e.g., "(?s-i)" turns on single line
       mode and turns off case insensitivity.

       Embedded modifiers may also be added to a non-capturing grouping.  "(?i-m:regexp)" is a  non-
       capturing grouping that matches "regexp" case insensitively and turns off multi-line mode.

   Looking ahead and looking behind
       This section concerns the lookahead and lookbehind assertions.  First, a little background.

       In  Perl  regular  expressions, most regexp elements "eat up" a certain amount of string when
       they match.  For instance, the regexp element "[abc]" eats up one  character  of  the  string
       when  it  matches,  in the sense that Perl moves to the next character position in the string
       after the match.  There are some elements, however, that don't eat up characters (advance the
       character position) if they match.  The examples we have seen so far are  the  anchors.   The
       anchor '^' matches the beginning of the line, but doesn't eat any characters.  Similarly, the
       word  boundary  anchor "\b" matches wherever a character matching "\w" is next to a character
       that doesn't, but it doesn't eat up any characters itself.  Anchors  are  examples  of  zero-
       width  assertions:  zero-width,  because  they consume no characters, and assertions, because
       they test some property of the string.  In the context of our walk in the  woods  analogy  to
       regexp  matching,  most  regexp  elements  move  us along a trail, but anchors have us stop a
       moment and check our surroundings.  If the local  environment  checks  out,  we  can  proceed
       forward.  But if the local environment doesn't satisfy us, we must backtrack.

       Checking  the environment entails either looking ahead on the trail, looking behind, or both.
       '^' looks behind, to see that there are no characters before.  '$' looks ahead, to  see  that
       there are no characters after.  "\b" looks both ahead and behind, to see if the characters on
       either side differ in their "word-ness".

       The lookahead and lookbehind assertions are generalizations of the anchor concept.  Lookahead
       and lookbehind are zero-width assertions that let us specify which characters we want to test
       for.  The lookahead assertion is denoted by "(?=regexp)" or (starting in 5.32, experimentally
       in  5.28)  "(*pla:regexp)" or "(*positive_lookahead:regexp)"; and the lookbehind assertion is
       denoted  by   "(?<=fixed-regexp)"   or   (starting   in   5.32,   experimentally   in   5.28)
       "(*plb:fixed-regexp)" or "(*positive_lookbehind:fixed-regexp)".  Some examples are

           $x = "I catch the housecat 'Tom-cat' with catnip";
           $x =~ /cat(*pla:\s)/;   # matches 'cat' in 'housecat'
           @catwords = ($x =~ /(?<=\s)cat\w+/g);  # matches,
                                                  # $catwords[0] = 'catch'
                                                  # $catwords[1] = 'catnip'
           $x =~ /\bcat\b/;  # matches 'cat' in 'Tom-cat'
           $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
                                     # middle of $x

       Note  that the parentheses in these are non-capturing, since these are zero-width assertions.
       Thus in the second regexp, the substrings captured are those  of  the  whole  regexp  itself.
       Lookahead  can match arbitrary regexps, but lookbehind prior to 5.30 "(?<=fixed-regexp)" only
       works  for  regexps  of  fixed  width,  i.e.,  a  fixed  number  of  characters  long.   Thus
       "(?<=(ab|bc))" is fine, but "(?<=(ab)*)" prior to 5.30 is not.

       The  negated  versions of the lookahead and lookbehind assertions are denoted by "(?!regexp)"
       and "(?<!fixed-regexp)"  respectively.   Or,  starting  in  5.32  (experimentally  in  5.28),
       "(*nla:regexp)",          "(*negative_lookahead:regexp)",         "(*nlb:regexp)",         or
       "(*negative_lookbehind:regexp)".  They evaluate true if the regexps do not match:

           $x = "foobar";
           $x =~ /foo(?!bar)/;  # doesn't match, 'bar' follows 'foo'
           $x =~ /foo(?!baz)/;  # matches, 'baz' doesn't follow 'foo'
           $x =~ /(?<!\s)foo/;  # matches, there is no \s before 'foo'

       Here is an example where a string containing blank-separated words, numbers and single dashes
       is to be split into its components.  Using "/\s+/" alone won't work, because spaces  are  not
       required  between  dashes, or a word or a dash. Additional places for a split are established
       by looking ahead and behind:

           $str = "one two - --6-8";
           @toks = split / \s+              # a run of spaces
                         | (?<=\S) (?=-)    # any non-space followed by '-'
                         | (?<=-)  (?=\S)   # a '-' followed by any non-space
                         /x, $str;          # @toks = qw(one two - - - 6 - 8)

   Using independent subexpressions to prevent backtracking
       Independent subexpressions (or atomic subexpressions) are regular expressions, in the context
       of a larger regular expression, that function independently of the larger regular expression.
       That is, they consume as much or as little of the string as they wish without regard for  the
       ability  of  the  larger  regexp  to  match.   Independent  subexpressions are represented by
       "(?>regexp)" or (starting in  5.32,  experimentally  in  5.28)  "(*atomic:regexp)".   We  can
       illustrate their behavior by first considering an ordinary regexp:

           $x = "ab";
           $x =~ /a*ab/;  # matches

       This  obviously matches, but in the process of matching, the subexpression "a*" first grabbed
       the 'a'.  Doing so, however, wouldn't allow the whole regexp to match, so after backtracking,
       "a*" eventually gave back the 'a' and matched the empty string.  Here, what "a*" matched  was
       dependent on what the rest of the regexp matched.

       Contrast that with an independent subexpression:

           $x =~ /(?>a*)ab/;  # doesn't match!

       The  independent subexpression "(?>a*)" doesn't care about the rest of the regexp, so it sees
       an 'a' and grabs it.  Then the rest of the regexp "ab" cannot  match.   Because  "(?>a*)"  is
       independent,  there is no backtracking and the independent subexpression does not give up its
       'a'.  Thus the match of the regexp  as  a  whole  fails.   A  similar  behavior  occurs  with
       completely independent regexps:

           $x = "ab";
           $x =~ /a*/g;   # matches, eats an 'a'
           $x =~ /\Gab/g; # doesn't match, no 'a' available

       Here  "/g"  and  "\G" create a "tag team" handoff of the string from one regexp to the other.
       Regexps with an independent subexpression are much like this, with a handoff of the string to
       the independent subexpression, and a handoff of the string back to the enclosing regexp.

       The ability of an independent subexpression to prevent  backtracking  can  be  quite  useful.
       Suppose  we  want  to match a non-empty string enclosed in parentheses up to two levels deep.
       Then the following regexp matches:

           $x = "abc(de(fg)h";  # unbalanced parentheses
           $x =~ /\( ( [ ^ () ]+ | \( [ ^ () ]* \) )+ \)/xx;

       The regexp matches an open parenthesis, one or more copies of an  alternation,  and  a  close
       parenthesis.   The  alternation  is  two-way,  with the first alternative "[^()]+" matching a
       substring with no parentheses and the second alternative "\([^()]*\)"  matching  a  substring
       delimited  by  parentheses.   The problem with this regexp is that it is pathological: it has
       nested indeterminate quantifiers of the form "(a+|b)+".  We discussed in Part  1  how  nested
       quantifiers  like  this could take an exponentially long time to execute if there is no match
       possible.  To prevent the exponential blowup, we need to prevent useless backtracking at some
       point.  This can be done by enclosing the inner quantifier as an independent subexpression:

           $x =~ /\( ( (?> [ ^ () ]+ ) | \([ ^ () ]* \) )+ \)/xx;

       Here, "(?>[^()]+)" breaks the degeneracy of string partitioning by gobbling up as much of the
       string as possible and keeping it.   Then match failures fail much more quickly.

   Conditional expressions
       A conditional expression is a form of if-then-else statement that allows one to choose  which
       patterns  are  to  be  matched,  based on some condition.  There are two types of conditional
       expression:     "(?(condition)yes-regexp)"     and      "(?(condition)yes-regexp|no-regexp)".
       "(?(condition)yes-regexp)"  is  like  an  'if () {}'  statement in Perl.  If the condition is
       true, the yes-regexp will be matched.  If the condition is  false,  the  yes-regexp  will  be
       skipped  and  Perl  will  move  onto  the  next  regexp  element.  The second form is like an
       'if () {} else {}' statement in Perl.  If the condition  is  true,  the  yes-regexp  will  be
       matched, otherwise the no-regexp will be matched.

       The  condition  can  have  several forms.  The first form is simply an integer in parentheses
       "(integer)".  It is true if the corresponding backreference "\integer" matched earlier in the
       regexp.  The same thing can be done with a name associated with a capture group,  written  as
       "(<name>)"  or "('name')".  The second form is a bare zero-width assertion "(?...)", either a
       lookahead, a lookbehind, or a code assertion (discussed in the next section).  The third  set
       of  forms  provides  tests  that return true if the expression is executed within a recursion
       ("(R)") or is being called from some capturing group, referenced either  by  number  ("(R1)",
       "(R2)",...) or by name ("(R&name)").

       The  integer or name form of the "condition" allows us to choose, with more flexibility, what
       to match based on what matched earlier in the regexp. This searches for  words  of  the  form
       "$x$x" or "$x$y$y$x":

           % simple_grep '^(\w+)(\w+)?(?(2)\g2\g1|\g1)$' /usr/dict/words
           beriberi
           coco
           couscous
           deed
           ...
           toot
           toto
           tutu

       The lookbehind "condition" allows, along with backreferences, an earlier part of the match to
       influence a later part of the match.  For instance,

           /[ATGC]+(?(?<=AA)G|C)$/;

       matches a DNA sequence such that it either ends in "AAG", or some other base pair combination
       and 'C'.  Note that the form is "(?(?<=AA)G|C)" and not "(?((?<=AA))G|C)"; for the lookahead,
       lookbehind or code assertions, the parentheses around the conditional are not needed.

   Defining named patterns
       Some  regular  expressions  use  identical subpatterns in several places.  Starting with Perl
       5.10, it is possible to define named subpatterns in a section of the pattern so that they can
       be called up by name anywhere in the pattern.  This syntactic  pattern  for  this  definition
       group  is  "(?(DEFINE)(?<name>pattern)...)".   An  insertion of a named pattern is written as
       "(?&name)".

       The example below illustrates this feature using the pattern for floating point numbers  that
       was  presented  earlier  on.   The  three  subpatterns  that  are used more than once are the
       optional sign, the digit sequence for an integer and  the  decimal  fraction.   The  "DEFINE"
       group  at the end of the pattern contains their definition.  Notice that the decimal fraction
       pattern is the first place where we can reuse the integer pattern.

          /^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
             (?: [eE](?&osg)(?&int) )?
           $
           (?(DEFINE)
             (?<osg>[-+]?)         # optional sign
             (?<int>\d++)          # integer
             (?<dec>\.(?&int))     # decimal fraction
           )/x

   Recursive patterns
       This feature (introduced in Perl 5.10) significantly extends  the  power  of  Perl's  pattern
       matching.   By  referring  to  some  other  capture  group  anywhere  in the pattern with the
       construct "(?group-ref)", the pattern within the referenced group is used as  an  independent
       subpattern  in  place  of  the  group  reference  itself.  Because the group reference may be
       contained within the group it refers to, it is now possible  to  apply  pattern  matching  to
       tasks that hitherto required a recursive parser.

       To  illustrate  this  feature,  we'll  design  a  pattern that matches if a string contains a
       palindrome. (This is a word or a sentence that, while ignoring spaces,  interpunctuation  and
       case,  reads the same backwards as forwards. We begin by observing that the empty string or a
       string containing just one word character is a palindrome. Otherwise  it  must  have  a  word
       character up front and the same at its end, with another palindrome in between.

        /(?: (\w) (?...Here be a palindrome...) \g{ -1 } | \w? )/x

       Adding  "\W*"  at  either  end  to  eliminate what is to be ignored, we already have the full
       pattern:

           my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
           for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
               print "'$s' is a palindrome\n" if $s =~ /$pp/;
           }

       In "(?...)" both absolute and relative backreferences may be used.  The entire pattern can be
       reinserted with "(?R)" or "(?0)".  If you prefer to name your groups, you can use  "(?&name)"
       to recurse into that group.

   A bit of magic: executing Perl code in a regular expression
       Normally,  regexps  are  a  part  of Perl expressions.  Code evaluation expressions turn that
       around by allowing arbitrary Perl code  to  be  a  part  of  a  regexp.   A  code  evaluation
       expression is denoted "(?{code})", with code a string of Perl statements.

       Code  expressions  are  zero-width  assertions,  and  the  value they return depends on their
       environment.  There  are  two  possibilities:  either  the  code  expression  is  used  as  a
       conditional  in  a  conditional  expression  "(?(condition)...)",  or it is not.  If the code
       expression is a conditional, the code is evaluated and the result (i.e., the  result  of  the
       last  statement) is used to determine truth or falsehood.  If the code expression is not used
       as a conditional, the assertion always evaluates true and the result is put into the  special
       variable  $^R.   The  variable  $^R can then be used in code expressions later in the regexp.
       Here are some silly examples:

           $x = "abcdef";
           $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
                                                # prints 'Hi Mom!'
           $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
                                                # no 'Hi Mom!'

       Pay careful attention to the next example:

           $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
                                                # no 'Hi Mom!'
                                                # but why not?

       At first glance, you'd think that it shouldn't print, because obviously the "ddd" isn't going
       to match the target string. But look at this example:

           $x =~ /abc(?{print "Hi Mom!";})[dD]dd/; # doesn't match,
                                                   # but _does_ print

       Hmm. What happened here? If you've been following along, you  know  that  the  above  pattern
       should  be  effectively  (almost)  the same as the last one; enclosing the 'd' in a character
       class isn't going to change what it matches. So why does the first not print while the second
       one does?

       The answer lies in the optimizations the regexp engine makes. In  the  first  case,  all  the
       engine  sees  are plain old characters (aside from the "?{}" construct). It's smart enough to
       realize that the string 'ddd' doesn't occur in our target string before actually running  the
       pattern  through.  But in the second case, we've tricked it into thinking that our pattern is
       more complicated. It takes a look, sees our character class, and decides that it will have to
       actually run the pattern to determine whether or not  it  matches,  and  in  the  process  of
       running it hits the print statement before it discovers that we don't have a match.

       To  take  a  closer  look  at how the engine does optimizations, see the section "Pragmas and
       debugging" below.

       More fun with "?{}":

           $x =~ /(?{print "Hi Mom!";})/;         # matches,
                                                  # prints 'Hi Mom!'
           $x =~ /(?{$c = 1;})(?{print "$c";})/;  # matches,
                                                  # prints '1'
           $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
                                                  # prints '1'

       The bit of magic mentioned in the section title occurs when  the  regexp  backtracks  in  the
       process of searching for a match.  If the regexp backtracks over a code expression and if the
       variables  used  within are localized using "local", the changes in the variables produced by
       the code expression are undone! Thus, if we wanted to count how many times  a  character  got
       matched inside a group, we could use, e.g.,

           $x = "aaaa";
           $count = 0;  # initialize 'a' count
           $c = "bob";  # test if $c gets clobbered
           $x =~ /(?{local $c = 0;})         # initialize count
                  ( a                        # match 'a'
                    (?{local $c = $c + 1;})  # increment count
                  )*                         # do this any number of times,
                  aa                         # but match 'aa' at the end
                  (?{$count = $c;})          # copy local $c var into $count
                 /x;
           print "'a' count is $count, \$c variable is '$c'\n";

       This prints

           'a' count is 2, $c variable is 'bob'

       If  we replace the " (?{local $c = $c + 1;})" with " (?{$c = $c + 1;})", the variable changes
       are not undone during backtracking, and we get

           'a' count is 4, $c variable is 'bob'

       Note that only localized variable changes are undone.  Other side effects of code  expression
       execution are permanent.  Thus

           $x = "aaaa";
           $x =~ /(a(?{print "Yow\n";}))*aa/;

       produces

          Yow
          Yow
          Yow
          Yow

       The result $^R is automatically localized, so that it will behave properly in the presence of
       backtracking.

       This  example  uses  a  code  expression in a conditional to match a definite article, either
       'the' in English or 'der|die|das' in German:

           $lang = 'DE';  # use German
           ...
           $text = "das";
           print "matched\n"
               if $text =~ /(?(?{
                                 $lang eq 'EN'; # is the language English?
                                })
                              the |             # if so, then match 'the'
                              (der|die|das)     # else, match 'der|die|das'
                            )
                           /xi;

       Note    that    the     syntax     here     is     "(?(?{...})yes-regexp|no-regexp)",     not
       "(?((?{...}))yes-regexp|no-regexp)".   In  other  words, in the case of a code expression, we
       don't need the extra parentheses around the conditional.

       If you try to use code expressions where the code text is contained  within  an  interpolated
       variable, rather than appearing literally in the pattern, Perl may surprise you:

           $bar = 5;
           $pat = '(?{ 1 })';
           /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
           /foo(?{ 1 })$bar/;   # compiles ok, $bar interpolated
           /foo${pat}bar/;      # compile error!

           $pat = qr/(?{ $foo = 1 })/;  # precompile code regexp
           /foo${pat}bar/;      # compiles ok

       If  a regexp has a variable that interpolates a code expression, Perl treats the regexp as an
       error. If the code expression is precompiled into a variable, however, interpolating  is  ok.
       The question is, why is this an error?

       The reason is that variable interpolation and code expressions together pose a security risk.
       The  combination  is  dangerous  because many programmers who write search engines often take
       user input and plug it directly into a regexp:

           $regexp = <>;       # read user-supplied regexp
           $chomp $regexp;     # get rid of possible newline
           $text =~ /$regexp/; # search $text for the $regexp

       If the $regexp variable contains a code expression, the user  could  then  execute  arbitrary
       Perl  code.   For  instance,  some joker could search for "system('rm -rf *');" to erase your
       files.  In this sense, the combination of interpolation  and  code  expressions  taints  your
       regexp.   So  by default, using both interpolation and code expressions in the same regexp is
       not allowed.  If you're not concerned about malicious users, it is possible  to  bypass  this
       security check by invoking "use re 'eval'":

           use re 'eval';       # throw caution out the door
           $bar = 5;
           $pat = '(?{ 1 })';
           /foo${pat}bar/;      # compiles ok

       Another  form of code expression is the pattern code expression.  The pattern code expression
       is like a regular code expression, except that the result of the code evaluation  is  treated
       as a regular expression and matched immediately.  A simple example is

           $length = 5;
           $char = 'a';
           $x = 'aaaaabb';
           $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'

       This final example contains both ordinary and pattern code expressions.  It detects whether a
       binary string 1101010010001... has a Fibonacci spacing 0,1,1,2,3,5,...  of the '1''s:

           $x = "1101010010001000001";
           $z0 = ''; $z1 = '0';   # initial conditions
           print "It is a Fibonacci sequence\n"
               if $x =~ /^1         # match an initial '1'
                           (?:
                              ((??{ $z0 })) # match some '0'
                              1             # and then a '1'
                              (?{ $z0 = $z1; $z1 .= $^N; })
                           )+   # repeat as needed
                         $      # that is all there is
                        /x;
           printf "Largest sequence matched was %d\n", length($z1)-length($z0);

       Remember  that  $^N  is set to whatever was matched by the last completed capture group. This
       prints

           It is a Fibonacci sequence
           Largest sequence matched was 5

       Ha! Try that with your garden variety regexp package...

       Note that the variables $z0 and $z1 are not substituted  when  the  regexp  is  compiled,  as
       happens  for  ordinary  variables outside a code expression.  Rather, the whole code block is
       parsed as perl code at the same time as perl is compiling the  code  containing  the  literal
       regexp pattern.

       This regexp without the "/x" modifier is

           /^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/

       which shows that spaces are still possible in the code parts. Nevertheless, when working with
       code  and  conditional  expressions,  the  extended  form  of  regexps is almost necessary in
       creating and debugging regexps.

   Backtracking control verbs
       Perl 5.10 introduced a number of control verbs intended to provide detailed control over  the
       backtracking  process,  by directly influencing the regexp engine and by providing monitoring
       techniques.  See "Special Backtracking Control Verbs" in perlre for a detailed description.

       Below is just one example, illustrating the control verb "(*FAIL)", which may be  abbreviated
       as "(*F)". If this is inserted in a regexp it will cause it to fail, just as it would at some
       mismatch  between  the pattern and the string. Processing of the regexp continues as it would
       after any "normal" failure, so that, for instance, the next position in the string or another
       alternative will be tried. As failing to match doesn't preserve  capture  groups  or  produce
       results, it may be necessary to use this in combination with embedded code.

          %count = ();
          "supercalifragilisticexpialidocious" =~
              /([aeiou])(?{ $count{$1}++; })(*FAIL)/i;
          printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);

       The  pattern  begins  with  a  class  matching a subset of letters.  Whenever this matches, a
       statement  like  "$count{'a'}++;"  is  executed,  incrementing  the  letter's  counter.  Then
       "(*FAIL)" does what it says, and the regexp engine proceeds according to the book: as long as
       the  end  of  the  string  hasn't  been  reached, the position is advanced before looking for
       another vowel. Thus, match or no match makes no difference, and the  regexp  engine  proceeds
       until  the  entire  string has been inspected.  (It's remarkable that an alternative solution
       using something like

          $count{lc($_)}++ for split('', "supercalifragilisticexpialidocious");
          printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );

       is considerably slower.)

   Pragmas and debugging
       Speaking of debugging, there are several pragmas available to control and  debug  regexps  in
       Perl.  We have already encountered one pragma in the previous section, "use re 'eval';", that
       allows variable interpolation and code expressions to coexist in a regexp.  The other pragmas
       are

           use re 'taint';
           $tainted = <>;
           @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted

       The  "taint"  pragma causes any substrings from a match with a tainted variable to be tainted
       as well, if your perl supports tainting (see perlsec).  This is not  normally  the  case,  as
       regexps  are  often  used to extract the safe bits from a tainted variable.  Use "taint" when
       you are not extracting safe bits, but are performing some other processing.  Both "taint" and
       "eval" pragmas are lexically scoped, which means they are in effect only until the end of the
       block enclosing the pragmas.

           use re '/m';  # or any other flags
           $multiline_string =~ /^foo/; # /m is implied

       The "re '/flags'" pragma (introduced in Perl 5.14) turns  on  the  given  regular  expression
       flags until the end of the lexical scope.  See "'/flags' mode" in re for more detail.

           use re 'debug';
           /^(.*)$/s;       # output debugging info

           use re 'debugcolor';
           /^(.*)$/s;       # output debugging info in living color

       The  global  "debug"  and "debugcolor" pragmas allow one to get detailed debugging info about
       regexp compilation and execution.  "debugcolor" is the same as debug,  except  the  debugging
       information  is  displayed  in  color  on terminals that can display termcap color sequences.
       Here is example output:

           % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
           Compiling REx 'a*b+c'
           size 9 first at 1
              1: STAR(4)
              2:   EXACT <a>(0)
              4: PLUS(7)
              5:   EXACT <b>(0)
              7: EXACT <c>(9)
              9: END(0)
           floating 'bc' at 0..2147483647 (checking floating) minlen 2
           Guessing start of match, REx 'a*b+c' against 'abc'...
           Found floating substr 'bc' at offset 1...
           Guessed: match at offset 0
           Matching REx 'a*b+c' against 'abc'
             Setting an EVAL scope, savestack=3
              0 <> <abc>           |  1:  STAR
                                    EXACT <a> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              1 <a> <bc>           |  4:    PLUS
                                    EXACT <b> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              2 <ab> <c>           |  7:      EXACT <c>
              3 <abc> <>           |  9:      END
           Match successful!
           Freeing REx: 'a*b+c'

       If you have gotten this far into the tutorial, you can  probably  guess  what  the  different
       parts of the debugging output tell you.  The first part

           Compiling REx 'a*b+c'
           size 9 first at 1
              1: STAR(4)
              2:   EXACT <a>(0)
              4: PLUS(7)
              5:   EXACT <b>(0)
              7: EXACT <c>(9)
              9: END(0)

       describes  the compilation stage.  STAR(4) means that there is a starred object, in this case
       'a', and if it matches,  goto  line  4,  i.e.,  PLUS(7).   The  middle  lines  describe  some
       heuristics and optimizations performed before a match:

           floating 'bc' at 0..2147483647 (checking floating) minlen 2
           Guessing start of match, REx 'a*b+c' against 'abc'...
           Found floating substr 'bc' at offset 1...
           Guessed: match at offset 0

       Then the match is executed and the remaining lines describe the process:

           Matching REx 'a*b+c' against 'abc'
             Setting an EVAL scope, savestack=3
              0 <> <abc>           |  1:  STAR
                                    EXACT <a> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              1 <a> <bc>           |  4:    PLUS
                                    EXACT <b> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              2 <ab> <c>           |  7:      EXACT <c>
              3 <abc> <>           |  9:      END
           Match successful!
           Freeing REx: 'a*b+c'

       Each step is of the form "n <x> <y>", with "<x>" the part of the string matched and "<y>" the
       part  not  yet  matched.   The  "|  1:  STAR"  says  that  Perl  is  at  line number 1 in the
       compilation list above.  See "Debugging Regular Expressions" in  perldebguts  for  much  more
       detail.

       An  alternative method of debugging regexps is to embed "print" statements within the regexp.
       This provides a blow-by-blow account of the backtracking in an alternation:

           "that this" =~ m@(?{print "Start at position ", pos, "\n";})
                            t(?{print "t1\n";})
                            h(?{print "h1\n";})
                            i(?{print "i1\n";})
                            s(?{print "s1\n";})
                                |
                            t(?{print "t2\n";})
                            h(?{print "h2\n";})
                            a(?{print "a2\n";})
                            t(?{print "t2\n";})
                            (?{print "Done at position ", pos, "\n";})
                           @x;

       prints

           Start at position 0
           t1
           h1
           t2
           h2
           a2
           t2
           Done at position 4

SEE ALSO
       This is just a tutorial.  For the full story on Perl  regular  expressions,  see  the  perlre
       regular expressions reference page.

       For  more  information  on  the matching "m//" and substitution "s///" operators, see "Regexp
       Quote-Like Operators" in perlop.  For information on the "split" operation,  see  "split"  in
       perlfunc.

       For  an excellent all-around resource on the care and feeding of regular expressions, see the
       book  Mastering  Regular  Expressions  by  Jeffrey  Friedl  (published  by   O'Reilly,   ISBN
       1556592-257-3).

AUTHOR AND COPYRIGHT
       Copyright (c) 2000 Mark Kvale.  All rights reserved.  Now maintained by Perl porters.

       This document may be distributed under the same terms as Perl itself.

   Acknowledgments
       The inspiration for the stop codon DNA example came from the ZIP code example in chapter 7 of
       Mastering Regular Expressions.

       The  author would like to thank Jeff Pinyan, Andrew Johnson, Peter Haworth, Ronald J Kimball,
       and Joe Smith for all their helpful comments.

perl v5.38.2                                 2026-08-18                                 PERLRETUT(1)
perlretut(1) □✕
NAME DESCRIPTION Part 1: The basics
Simple word matching Using character classes Matching this or that Grouping things and hierarchical matching Extracting matches Backreferences Relative backreferences Named backreferences Alternative capture group numbering Position information Non-capturing groupings Matching repetitions Possessive quantifiers Building a regexp Using regular expressions in Perl
Part 2: Power tools
More on characters, strings, and character classes Compiling and saving regular expressions Composing regular expressions at runtime Embedding comments and modifiers in a regular expression Looking ahead and looking behind Using independent subexpressions to prevent backtracking Conditional expressions Defining named patterns Recursive patterns A bit of magic: executing Perl code in a regular expression Backtracking control verbs Pragmas and debugging
SEE ALSO AUTHOR AND COPYRIGHT
Acknowledgments

Generated by phpman v4.11.2-34-g91cb020 · Markdown · JSON · MCP Author: Che Dong Under GNU General Public License
2026-10-05 03:55 @216.73.216.55
CrawledBy Mozilla/5.0 AppleWebKit/537.36 (KHTML, like Gecko; compatible; ClaudeBot/1.0; +claudebot@anthropic.com)
Valid XHTML 1.0 Transitional!Valid CSS!

^_top_^